Physics
Physics
41 questions with worked solutions · diagram-based questions omitted
Physics · Question 1
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is
- 2W/A
- W/A
- W/2A
- Zero
Correct option — (2) W/A
Stress is defined as the internal restoring force set up per unit area of cross-section.
The wire is in equilibrium, so the tension at every point equals the weight hanging at the free end:
\(T = W\)
This tension acts across the cross-sectional area \(A\), and since the force is along the length of the wire, the stress is longitudinal:
$$\text{Longitudinal stress} = \frac{F}{A} = \frac{W}{A}$$
Note that the stress does not double — the ceiling's reaction and the weight form an action–reaction pair across the same section, not two separate loads.
From the chapter Properties of Solids and Liquids — notes · practice set
Physics · Question 2
The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is
- 3 : 5
- 5 : 3
- 2 : 5
- 5 : 2
None of the given options is correct. Correct value: \(\sqrt{3/5}\).
Radius of gyration \(k\) is defined through \(I = Mk^2\), so \(k = \sqrt{I/M}\).
Solid sphere about a diameter: \(I = \dfrac{2}{5}MR^2\)
$$k_1 = \sqrt{\frac{2}{5}}\,R$$
Thin hollow sphere about a diameter: \(I = \dfrac{2}{3}MR^2\)
$$k_2 = \sqrt{\frac{2}{3}}\,R$$
Taking the ratio:
$$\frac{k_1}{k_2} = \sqrt{\frac{2}{5}} \times \sqrt{\frac{3}{2}} = \sqrt{\frac{3}{5}}$$
This value, \(\sqrt{3/5}\), does not match any of the four options. Option (1) reads 3 : 5, which is the ratio inside the square root — the square root was not taken. This question was treated as a bonus.
From the chapter Rotational Motion — notes · practice set
Physics · Question 3
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is
- Along eastward
- Along northward
- Along north-east
- Along south-west
Correct option — (3) Along north-east
Force has the same direction as the change in momentum, not the direction of motion:
$$\vec{F} = \frac{\Delta \vec{p}}{\Delta t}, \qquad \Delta\vec{p} = \vec{p}_f - \vec{p}_i$$
Take east as \(\hat{i}\) and north as \(\hat{j}\). The player moves south initially and east finally, both with speed \(u\):
\(\vec{p}_i = -mu\,\hat{j}\) (southward)
\(\vec{p}_f = mu\,\hat{i}\) (eastward)
$$\Delta\vec{p} = mu\,\hat{i} - (-mu\,\hat{j}) = mu(\hat{i} + \hat{j})$$
The vector \(\hat{i}+\hat{j}\) has equal components along east and north, so it points north-east. The force is therefore along north-east.
A common mistake here is answering "eastward" because that is where the player ends up going — but the force must also cancel the original southward momentum, which is why it tilts northward too.
From the chapter Laws of Motion — notes · practice set
Physics · Question 4
If \(\oint_s \vec{E} \cdot \overrightarrow{dS} = 0\) over a surface, then
- The number of flux lines entering the surface must be equal to the number of flux lines leaving it
- The magnitude of electric field on the surface is constant
- All the charges must necessarily be inside the surface
- The electric field inside the surface is necessarily uniform
Correct option — (1) The number of flux lines entering the surface must be equal to the number of flux lines leaving it
The integral \(\oint_s \vec{E}\cdot\overrightarrow{dS}\) is the net electric flux through the closed surface. Being zero means:
$$\phi_{\text{net}} = \phi_{\text{out}} - \phi_{\text{in}} = 0 \;\Rightarrow\; \phi_{\text{out}} = \phi_{\text{in}}$$
So exactly as many field lines leave the surface as enter it. That is option (1).
Why the others fail:
• Zero net flux says nothing about the magnitude of \(\vec{E}\) at each point — the field can vary freely over the surface.
• By Gauss's law \(\phi = q_{\text{enclosed}}/\varepsilon_0\), zero flux means the net enclosed charge is zero. Equal positive and negative charges could sit inside, or there could be no charge at all — it does not force charges to be inside.
• The field inside need not be uniform; zero flux is a statement about the boundary only.
From the chapter Electrostatics — notes · practice set
Physics · Question 5
The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be
- 2 U
- 4 U
- 8 U
- 16 U
Correct option — (4) 16 U
Elastic potential energy of a spring depends on the square of the extension:
$$U = \tfrac{1}{2}kx^2 \;\Rightarrow\; U \propto x^2$$
The extension goes from 2 cm to 8 cm — a factor of 4. Since energy scales as the square:
$$\frac{U'}{U} = \left(\frac{x'}{x}\right)^2 = \left(\frac{8}{2}\right)^2 = 4^2 = 16$$
$$U' = 16\,U$$
The trap is answering 4U by assuming energy scales linearly with extension.
From the chapter Work, Energy and Power — notes · practice set
Physics · Question 6
A 12 V, 60 W lamp is connected to the secondary of a step-down transformer, whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?
- 0.27 A
- 2.7 A
- 3.7 A
- 0.37 A
Correct option — (1) 0.27 A
For an ideal transformer there are no losses, so power in equals power out:
$$P_{\text{primary}} = P_{\text{secondary}}$$
The lamp consumes 60 W, so the primary must draw 60 W as well:
$$V_p I_p = 60$$
$$220 \times I_p = 60$$
$$I_p = \frac{60}{220} \approx 0.27\ \text{A}$$
Note that the 12 V rating is not needed for the primary current — it only tells you the transformer steps down. The secondary current would be \(60/12 = 5\) A, which is much larger, exactly as expected for a step-down transformer.
From the chapter Electromagnetic Induction and AC — notes · practice set
Physics · Question 7
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
- A centre-tapped transformer
- p-n junction diodes
- Capacitor
- Load resistance
Correct option — (3) Capacitor
Each component has a distinct job in the rectifier:
• The centre-tapped transformer supplies two equal, opposite-phase voltages to the two diodes.
• The diodes conduct on alternate half cycles, converting ac into a pulsating dc — this is rectification, not smoothing.
• The load resistance is simply where the output is taken.
• The capacitor is the filter. It charges up when the rectified voltage rises and discharges slowly through the load when the voltage falls, filling in the dips between pulses. This flattens the pulsating output and removes the ac ripple.
So the capacitor is the answer. A larger capacitance gives a longer discharge time constant \(RC\) and therefore smaller ripple.
Physics · Question 8
Light travels a distance x in time t1 in air and 10x in time t2 in another denser medium. What is the critical angle for this medium?
- \(\sin^{-1}\left(\dfrac{t_2}{t_1}\right)\)
- \(\sin^{-1}\left(\dfrac{10t_2}{t_1}\right)\)
- \(\sin^{-1}\left(\dfrac{t_1}{10t_2}\right)\)
- \(\sin^{-1}\left(\dfrac{10t_1}{t_2}\right)\)
Correct option — (4) \sin^{-1}\left(\dfrac{10t_1}{t_2}\right)
Step 1 — find the speeds.
In air: \(v_1 = \dfrac{x}{t_1}\) In the medium: \(v_2 = \dfrac{10x}{t_2}\)
Step 2 — relate to refractive index.
Since \(\mu = c/v\), the refractive index is inversely proportional to speed:
$$\frac{\mu_1}{\mu_2} = \frac{v_2}{v_1}$$
Step 3 — apply the critical angle condition.
At the critical angle \(i_c\), light travelling from the denser medium (\(\mu_2\)) into the rarer one (\(\mu_1\)) refracts at 90°:
$$\mu_2 \sin i_c = \mu_1 \sin 90° \;\Rightarrow\; \sin i_c = \frac{\mu_1}{\mu_2} = \frac{v_2}{v_1}$$
$$\sin i_c = \frac{10x/t_2}{x/t_1} = \frac{10\,t_1}{t_2}$$
$$i_c = \sin^{-1}\left(\frac{10\,t_1}{t_2}\right)$$
From the chapter Optics — notes · practice set
Physics · Question 9
Resistance of a carbon resistor determined from colour codes is (22000 ± 5%) Ω. The colour of third band must be
- Red
- Green
- Orange
- Yellow
Correct option — (3) Orange
In the four-band colour code, the first two bands give the significant digits, the third band is the decimal multiplier, and the fourth is the tolerance.
Write the resistance in standard form:
$$22000\ \Omega = 22 \times 10^3\ \Omega$$
So the significant digits are 2 and 2, and the multiplier is \(10^3\).
Reading the multiplier off the colour code, the digit 3 corresponds to orange.
(For reference: black 0, brown 1, red 2, orange 3, yellow 4, green 5. The first two bands here would both be red, and the ±5% tolerance band would be gold.)
From the chapter Current Electricity — notes · practice set
Physics · Question 10
Given below are two statements:
Statement I: Photovoltaic devices can convert optical radiation into electricity.
Statement II: Zener diode is designed to operate under reverse bias in breakdown region.
In the light of the above statements, choose the most appropriate answer from the options given below.
- Both Statement I and Statement II are correct
- Both Statement I and Statement II are incorrect
- Statement I is correct but Statement II is incorrect
- Statement I is incorrect but Statement II is correct
Correct option — (1) Both Statement I and Statement II are correct
Statement I is correct. A photovoltaic device — a solar cell — is a p-n junction in which incident photons with energy greater than the band gap generate electron–hole pairs. The junction's built-in field separates these carriers, producing a photovoltage across the terminals. So optical radiation is indeed converted into electricity.
Statement II is correct. An ordinary diode is destroyed if driven into reverse breakdown, but a Zener diode is heavily doped so that its depletion layer is very thin and breakdown occurs at a low, sharply defined reverse voltage. It is built to operate there safely and continuously. Once in breakdown, the voltage across it stays almost constant even as current varies — which is why it works as a voltage regulator.
Both statements are correct.
Physics · Question 11
The magnetic energy stored in an inductor of inductance 4 µH carrying a current of 2 A is
- 4 µJ
- 4 mJ
- 8 mJ
- 8 µJ
Correct option — (4) 8 µJ
Energy stored in the magnetic field of an inductor:
$$U = \tfrac{1}{2}Li^2$$
Substituting \(L = 4\ \mu\text{H} = 4 \times 10^{-6}\) H and \(i = 2\) A:
$$U = \tfrac{1}{2} \times 4 \times 10^{-6} \times (2)^2$$
$$U = \tfrac{1}{2} \times 4 \times 10^{-6} \times 4 = 8 \times 10^{-6}\ \text{J}$$
$$U = 8\ \mu\text{J}$$
Watch the unit prefix — micro, not milli. The arithmetic gives 8, and the answer must stay in µJ because \(L\) was in µH.
From the chapter Electromagnetic Induction and AC — notes · practice set
Physics · Question 12
The angular acceleration of a body, moving along the circumference of a circle, is
- Along the radius, away from centre
- Along the radius towards the centre
- Along the tangent to its position
- Along the axis of rotation
Correct option — (4) Along the axis of rotation
Angular quantities — angular velocity \(\vec{\omega}\) and angular acceleration \(\vec{\alpha}\) — are axial vectors. They are not directed along the circular path itself.
Since
$$\vec{\alpha} = \frac{d\vec{\omega}}{dt}$$
and \(\vec{\omega}\) always points along the axis of rotation (its sense given by the right-hand rule), any change in \(\vec{\omega}\) for a body confined to a fixed circular path must also lie along that same axis. So \(\vec{\alpha}\) is along the axis of rotation.
Don't confuse this with the linear quantities: centripetal acceleration points towards the centre, and tangential acceleration lies along the tangent. Those are different vectors.
From the chapter Rotational Motion — notes · practice set
Physics · Question 13
A Carnot engine has an efficiency of 50% when its source is at a temperature 327°C. The temperature of the sink is
- 27°C
- 15°C
- 100°C
- 200°C
Correct option — (1) 27°C
Efficiency of a Carnot engine depends only on the two absolute temperatures:
$$\eta = 1 - \frac{T_{\text{sink}}}{T_{\text{source}}}$$
Convert to kelvin first — this is essential, the formula fails with Celsius:
$$T_{\text{source}} = 327 + 273 = 600\ \text{K}$$
Given \(\eta = 50\% = \dfrac{1}{2}\):
$$\frac{1}{2} = 1 - \frac{T_{\text{sink}}}{600}$$
$$\frac{T_{\text{sink}}}{600} = \frac{1}{2} \;\Rightarrow\; T_{\text{sink}} = 300\ \text{K}$$
Convert back:
$$T_{\text{sink}} = 300 - 273 = 27°\text{C}$$
From the chapter Thermodynamics — notes · practice set
Physics · Question 14
Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant)
- \(-\dfrac{8Gm}{R}\)
- \(-\dfrac{12Gm}{R}\)
- \(-\dfrac{16Gm}{R}\)
- \(-\dfrac{20Gm}{R}\)
Correct option — (3) -\dfrac{16Gm}{R}
Step 1 — locate the null point.
Let the field vanish at distance \(x\) from the mass \(m\), so it is \((R-x)\) from \(9m\). The two field contributions are opposite in direction and must be equal in magnitude:
$$\frac{Gm}{x^2} = \frac{G(9m)}{(R-x)^2}$$
$$\frac{(R-x)^2}{x^2} = 9 \;\Rightarrow\; \frac{R-x}{x} = 3$$
$$R - x = 3x \;\Rightarrow\; x = \frac{R}{4}, \qquad R - x = \frac{3R}{4}$$
Step 2 — find the potential there.
Potential is a scalar, so the two contributions simply add (both negative — they do not cancel):
$$V = -\frac{Gm}{x} - \frac{G(9m)}{R-x}$$
$$V = -\frac{Gm}{R/4} - \frac{9Gm}{3R/4}$$
$$V = -\frac{4Gm}{R} - \frac{12Gm}{R} = -\frac{16Gm}{R}$$
The key idea: field is a vector and can cancel to zero, but potential is a scalar and does not.
From the chapter Gravitation — notes · practice set
Physics · Question 15
A vehicle travels half the distance with speed v and the remaining distance with speed 2v. Its average speed is
- \(\dfrac{v}{3}\)
- \(\dfrac{2v}{3}\)
- \(\dfrac{4v}{3}\)
- \(\dfrac{3v}{4}\)
Correct option — (3) \dfrac{4v}{3}
Average speed is total distance divided by total time — never the plain average of the two speeds.
Let the total distance be \(2d\), so each half is \(d\).
$$t_1 = \frac{d}{v}, \qquad t_2 = \frac{d}{2v}$$
$$t_{\text{total}} = \frac{d}{v} + \frac{d}{2v} = \frac{2d + d}{2v} = \frac{3d}{2v}$$
$$v_{\text{avg}} = \frac{2d}{3d/2v} = \frac{2d \times 2v}{3d} = \frac{4v}{3}$$
Equivalently, for equal distances the average speed is the harmonic mean:
$$v_{\text{avg}} = \frac{2v_1v_2}{v_1+v_2} = \frac{2 \cdot v \cdot 2v}{v + 2v} = \frac{4v}{3}$$
Note \(4v/3 = 1.33v\), which is less than the arithmetic mean \(1.5v\) — as it must be, since more time is spent at the slower speed.
From the chapter Kinematics — notes · practice set
Physics · Question 16
The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly (surface tension of soap solution = 0.03 N m−1)
- 30.16 × 10−4 J
- 5.06 × 10−4 J
- 3.01 × 10−4 J
- 50.1 × 10−4 J
Correct option — (3) 3.01 × 10−4 J
Work done in creating a surface equals surface tension times the area created:
$$W = S \times \Delta A$$
The critical point: a soap bubble has two surfaces — an inner one and an outer one, both in contact with air. So the area created is twice the spherical area:
$$\Delta A = 2 \times 4\pi r^2$$
With \(r = 2\ \text{cm} = 2 \times 10^{-2}\) m:
$$\Delta A = 2 \times 4\pi \times (2\times10^{-2})^2 = 2 \times 4\pi \times 4 \times 10^{-4}$$
$$W = 0.03 \times 2 \times 4\pi \times 4 \times 10^{-4}$$
$$W = 3.015 \times 10^{-4}\ \text{J} \approx 3.01 \times 10^{-4}\ \text{J}$$
If you forget the factor of 2, you get roughly \(1.5 \times 10^{-4}\) J and no option matches. A liquid drop, by contrast, has only one surface.
From the chapter Properties of Solids and Liquids — notes · practice set
Physics · Question 17
The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to
- \(\sqrt{V}\)
- \(\dfrac{1}{V}\)
- \(\dfrac{1}{\sqrt{V}}\)
- \(V^2\)
Correct option — (2) \dfrac{1}{V}
The minimum wavelength (the cut-off of the continuous X-ray spectrum) corresponds to the extreme case where an electron loses all of its kinetic energy in a single collision, producing one photon.
Kinetic energy gained by the electron:
$$KE = eV$$
Setting this equal to the energy of the emitted photon:
$$eV = \frac{hc}{\lambda_{\min}}$$
$$\lambda_{\min} = \frac{hc}{eV}$$
Since \(h\), \(c\) and \(e\) are all constants:
$$\lambda_{\min} \propto \frac{1}{V}$$
This is the Duane–Hunt law. Note that \(\lambda_{\min}\) depends only on the accelerating voltage, not on the target material.
From the chapter Dual Nature of Matter and Radiation — notes · practice set
Physics · Question 18
The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to \(\left(\dfrac{1}{16}\right)^{th}\) of its initial value?
- 20 minutes
- 40 minutes
- 60 minutes
- 80 minutes
Correct option — (4) 80 minutes
After \(n\) half-lives the activity falls by a factor of \(2^n\):
$$\frac{A}{A_0} = \frac{1}{2^n}$$
We need the activity to drop to \(\dfrac{1}{16}\):
$$\frac{1}{16} = \frac{1}{2^n} \;\Rightarrow\; 2^n = 16 = 2^4 \;\Rightarrow\; n = 4$$
So four half-lives have elapsed:
$$t = n \times T_{1/2} = 4 \times 20 = 80\ \text{minutes}$$
Tracking it step by step: 1 → 1/2 (20 min) → 1/4 (40 min) → 1/8 (60 min) → 1/16 (80 min).
From the chapter Atoms and Nuclei — notes · practice set
Physics · Question 19
A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum possible percentage error in the measurement of density will nearly be
- 1.2%
- 1.3%
- 1.6%
- 1.4%
Correct option — (3) 1.6%
The wire is a cylinder, so its density is
$$\rho = \frac{M}{V} = \frac{M}{\pi r^2 \ell}$$
For a quantity built from products and powers, the fractional errors add, each weighted by its power. Here \(r\) appears squared, so its error is counted twice:
$$\frac{\Delta\rho}{\rho} = \frac{\Delta M}{M} + 2\frac{\Delta r}{r} + \frac{\Delta \ell}{\ell}$$
Substituting (units cancel within each ratio, so no conversion is needed):
$$\frac{\Delta\rho}{\rho} = \frac{0.002}{0.4} + \frac{2 \times 0.001}{0.3} + \frac{0.02}{5}$$
$$= 0.005 + 0.00667 + 0.004 = 0.0157$$
As a percentage:
$$\frac{\Delta\rho}{\rho} \times 100 \approx 1.56\% \approx 1.6\%$$
The factor of 2 on the radius term is what separates 1.6% from the wrong answer — the radius contributes the largest share of the error.
From the chapter Physics and Measurement — notes · practice set
Physics · Question 20
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of 2.0 × 1010 Hz and amplitude 48 V m−1. Then the amplitude of oscillating magnetic field is
(Speed of light in free space = 3 × 108 m s−1)
- 1.6 × 10−9 T
- 1.6 × 10−8 T
- 1.6 × 10−7 T
- 1.6 × 10−6 T
Correct option — (3) 1.6 × 10−7 T
In an electromagnetic wave in free space, the amplitudes of the electric and magnetic fields are locked together by the speed of light:
$$c = \frac{E_0}{B_0}$$
Rearranging for the magnetic field amplitude:
$$B_0 = \frac{E_0}{c} = \frac{48}{3 \times 10^8}$$
$$B_0 = 16 \times 10^{-8} = 1.6 \times 10^{-7}\ \text{T}$$
The frequency given (2.0 × 1010 Hz) is not needed — it is there as a distractor. The \(E_0/B_0\) ratio holds regardless of frequency.
From the chapter Electromagnetic Waves — notes · practice set
Physics · Question 21
The temperature of a gas is −50°C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?
- 669°C
- 3295°C
- 3097 K
- 223 K
Correct option — (2) 3295°C
The rms speed of gas molecules:
$$v_{\text{rms}} = \sqrt{\frac{3RT}{M}} \;\Rightarrow\; v_{\text{rms}} \propto \sqrt{T}$$
Read the wording carefully. "Increased by 3 times" means the speed increases by \(3v\), so the final speed is \(v + 3v = 4v\) — not \(3v\).
Initial temperature in kelvin:
$$T_1 = -50 + 273 = 223\ \text{K}$$
Using the proportionality:
$$\frac{v_1}{v_2} = \sqrt{\frac{T_1}{T_2}} \;\Rightarrow\; \frac{v}{4v} = \sqrt{\frac{223}{T_2}}$$
$$\frac{1}{16} = \frac{223}{T_2} \;\Rightarrow\; T_2 = 223 \times 16 = 3568\ \text{K}$$
The options are in Celsius, so convert:
$$T_2 = 3568 - 273 = 3295°\text{C}$$
From the chapter Kinetic Theory of Gases — notes · practice set
Physics · Question 22
An ac source is connected to a capacitor C. Due to decrease in its operating frequency
- Capacitive reactance decreases
- Displacement current increases
- Displacement current decreases
- Capacitive reactance remains constant
Correct option — (3) Displacement current decreases
Capacitive reactance is inversely proportional to frequency:
$$X_C = \frac{1}{\omega C} = \frac{1}{2\pi f C}$$
So if \(f\) decreases, \(X_C\) increases. This rules out options (1) and (4).
With the source voltage unchanged, a larger reactance means a smaller current:
$$I = \frac{V}{X_C}$$
Inside the capacitor no charge actually crosses the gap between the plates — the current there is carried by the changing electric field, which Maxwell called the displacement current. Its magnitude always equals the conduction current in the connecting wires.
So as the conduction current falls, the displacement current falls with it. Displacement current decreases.
From the chapter Electromagnetic Induction and AC — notes · practice set
Physics · Question 23
For Young's double slit experiment, two statements are given below:
Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant.
Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose the correct answer from the options given below:
- Both Statement I and Statement II are true.
- Both Statement I and Statement II are false.
- Statement I is true but Statement II is false.
- Statement I is false but Statement II is true.
Correct option — (3) Statement I is true but Statement II is false.
The angular fringe width in a double slit experiment is
$$\theta = \frac{\lambda}{d}$$
where \(d\) is the slit separation. Notice what is absent from this expression: the screen distance \(D\).
Statement I: Moving the screen away changes the linear fringe width \(\beta = \dfrac{\lambda D}{d}\), which grows with \(D\). But the angular separation \(\lambda/d\) has no \(D\) in it, so it stays constant. Statement I is true.
Statement II: Since \(\theta \propto \lambda\), a larger wavelength gives a larger angular separation, not a smaller one. Statement II is false.
So Statement I is true but Statement II is false.
From the chapter Optics — notes · practice set
Physics · Question 24
In hydrogen spectrum, the shortest wavelength in the Balmer series is λ. The shortest wavelength in the Bracket series is
- 2λ
- 4λ
- 9λ
- 16λ
Correct option — (2) 4λ
The Rydberg formula for hydrogen:
$$\frac{1}{\lambda} = R\left[\frac{1}{n_2^2} - \frac{1}{n_1^2}\right]$$
The shortest wavelength in any series is the series limit, obtained by taking \(n_1 = \infty\).
Balmer series (\(n_2 = 2\)):
$$\frac{1}{\lambda} = R\left[\frac{1}{4} - 0\right] \;\Rightarrow\; \lambda = \frac{4}{R}$$
Brackett series (\(n_2 = 4\)):
$$\frac{1}{\lambda'} = R\left[\frac{1}{16} - 0\right] \;\Rightarrow\; \lambda' = \frac{16}{R}$$
Dividing:
$$\frac{\lambda'}{\lambda} = \frac{16/R}{4/R} = 4 \;\Rightarrow\; \lambda' = 4\lambda$$
The ratio is simply \((n_2')^2/(n_2)^2 = 16/4 = 4\).
From the chapter Atoms and Nuclei — notes · practice set
Physics · Question 25
The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?
- Cs only
- Both Na and K
- K only
- Na only
Correct option — (1) Cs only
Photoemission occurs only when the incident photon energy is at least equal to the work function of the surface:
$$E \geq \phi_0$$
Compare the incident energy of 2.20 eV against each:
• Caesium: \(\phi_0 = 2.14\) eV. Since \(2.20 > 2.14\), emission occurs. The excess \(2.20 - 2.14 = 0.06\) eV appears as the maximum kinetic energy of the ejected electron.
• Potassium: \(\phi_0 = 2.30\) eV. Since \(2.20 < 2.30\), no emission.
• Sodium: \(\phi_0 = 2.75\) eV. Since \(2.20 < 2.75\), no emission.
Only caesium emits photoelectrons. Note that increasing the intensity of the radiation would not help K or Na — the threshold depends on photon energy, not on how many photons arrive.
From the chapter Dual Nature of Matter and Radiation — notes · practice set
Physics · Question 26
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are
- Instrumental errors
- Personal errors
- Least count errors
- Random errors
Correct option — (4) Random errors
Random errors are those that cannot be traced to any systematic or constant cause. They arise from unpredictable fluctuations in experimental conditions — temperature drift, voltage supply variation, small changes in pressure — and from the observer's own inconsistency in judgement. They vary irregularly in both size and sign, which is exactly the behaviour described here.
Why the others do not fit:
• Instrumental errors come from a defect or faulty calibration in the apparatus. They are systematic — the same bias every time, not fluctuating.
• Personal errors arise from the observer's carelessness or bias, such as parallax in reading a scale.
• Least count errors are set by the finite resolution of the instrument and are fixed for a given device.
Random errors can be reduced by taking many readings and averaging; systematic errors cannot.
From the chapter Physics and Measurement — notes · practice set
Physics · Question 27
In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 µF and resistance R is 100 Ω. The frequency at which resonance occurs is
- 15.9 rad/s
- 15.9 kHz
- 1.59 rad/s
- 1.59 kHz
Correct option — (4) 1.59 kHz
At resonance the inductive and capacitive reactances cancel (\(X_L = X_C\)), giving
$$f = \frac{1}{2\pi\sqrt{LC}}$$
Substitute \(L = 10\ \text{mH} = 10 \times 10^{-3}\) H and \(C = 1\ \mu\text{F} = 1 \times 10^{-6}\) F:
$$\sqrt{LC} = \sqrt{10 \times 10^{-3} \times 1 \times 10^{-6}} = \sqrt{10^{-8}} = 10^{-4}$$
$$f = \frac{1}{2\pi \times 10^{-4}} = \frac{10^4}{2\pi}$$
$$f \approx 1591\ \text{Hz} = 1.59\ \text{kHz}$$
Two traps here: the resistance \(R\) does not affect the resonant frequency at all (it only sets the sharpness of the peak), and the answer must be read in Hz — options (1) and (3) are in rad/s, which would be \(\omega = 10^4\) rad/s.
From the chapter Electromagnetic Induction and AC — notes · practice set
Physics · Question 28
The venturi-meter works on
- Huygen's principle
- Bernoulli's principle
- The principle of parallel axes
- The principle of perpendicular axes
Correct option — (2) Bernoulli's principle
A venturi-meter measures the flow rate of a fluid through a pipe. It has a constricted throat: as the fluid enters the narrower section, the equation of continuity \((A_1v_1 = A_2v_2)\) forces its speed to increase.
By Bernoulli's principle, along a streamline
$$P + \tfrac{1}{2}\rho v^2 + \rho g h = \text{constant}$$
so where the speed rises, the pressure must fall. Measuring the pressure difference between the wide section and the throat therefore gives the flow speed.
The other options belong elsewhere: Huygens' principle concerns wave propagation, and the parallel and perpendicular axes theorems are used for moment of inertia.
From the chapter Properties of Solids and Liquids — notes · practice set
Physics · Question 29
The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is
- 1 : 2
- 2 : 1
- 1 : 3
- 3 : 1
Correct option — (2) 2 : 1
Open pipe (open at both ends): antinodes form at both ends, so the pipe length holds half a wavelength.
$$\ell = \frac{\lambda}{2} \;\Rightarrow\; f_{\text{open}} = \frac{v}{2\ell}$$
Closed pipe (closed at one end): a node forms at the closed end and an antinode at the open end, so the pipe length holds a quarter wavelength.
$$\ell = \frac{\lambda}{4} \;\Rightarrow\; f_{\text{closed}} = \frac{v}{4\ell}$$
Taking the ratio for the same length \(\ell\) and same speed of sound \(v\):
$$\frac{f_{\text{open}}}{f_{\text{closed}}} = \frac{v/2\ell}{v/4\ell} = \frac{4\ell}{2\ell} = \frac{2}{1}$$
So the ratio is 2 : 1 — an open pipe sounds an octave higher than a closed pipe of the same length.
From the chapter Oscillations and Waves — notes · practice set
Physics · Question 30
An electric dipole is placed at an angle of 30° with an electric field of intensity 2 × 105 N C−1. It experiences a torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.
- 8 mC
- 6 mC
- 4 mC
- 2 mC
Correct option — (4) 2 mC
Torque on a dipole in a uniform electric field:
$$\vec{\tau} = \vec{p} \times \vec{E} \;\Rightarrow\; \tau = pE\sin\theta$$
Step 1 — find the dipole moment.
$$4 = p \times 2 \times 10^5 \times \sin 30°$$
$$4 = p \times 2 \times 10^5 \times 0.5 = p \times 10^5$$
$$p = 4 \times 10^{-5}\ \text{C m}$$
Step 2 — extract the charge.
Since \(p = q\ell\) with \(\ell = 2\ \text{cm} = 0.02\) m:
$$q = \frac{p}{\ell} = \frac{4 \times 10^{-5}}{0.02} = 2 \times 10^{-3}\ \text{C}$$
$$q = 2\ \text{mC}$$
From the chapter Electrostatics — notes · practice set
Physics · Question 31
The net magnetic flux through any closed surface is
- Zero
- Positive
- Infinity
- Negative
Correct option — (1) Zero
This is Gauss's law for magnetism, one of Maxwell's four equations:
$$\oint \vec{B} \cdot \overrightarrow{ds} = 0$$
The physical reason is that magnetic monopoles do not exist. Unlike electric charges, which can be isolated as a lone positive or negative charge, magnetic poles always come in pairs — cut a bar magnet in half and you get two smaller magnets, each with its own north and south pole.
As a result, magnetic field lines never begin or end anywhere; they always form closed loops. Every line that enters a closed surface must also leave it, so the inward and outward contributions cancel exactly and the net flux is always zero — for any closed surface, whatever its shape or position.
Contrast this with the electric case, where \(\oint \vec{E}\cdot\overrightarrow{dS} = q/\varepsilon_0\) can be non-zero because isolated charges do exist.
From the chapter Magnetic Effects of Current — notes · practice set
Physics · Question 32
A bullet is fired from a gun at the speed of 280 m s−1 in the direction 30° above the horizontal. The maximum height attained by the bullet is (g = 9.8 m s−2, sin30° = 0.5)
- 2800 m
- 2000 m
- 1000 m
- 3000 m
Correct option — (3) 1000 m
Only the vertical component of velocity matters for the height. At the highest point the vertical velocity is zero, giving
$$H = \frac{u^2\sin^2\theta}{2g}$$
Substituting \(u = 280\) m s−1, \(\theta = 30°\), \(g = 9.8\) m s−2:
$$H = \frac{(280)^2 \times (0.5)^2}{2 \times 9.8}$$
$$H = \frac{280 \times 280 \times 0.5 \times 0.5}{19.6}$$
$$H = \frac{19600}{19.6} = 1000\ \text{m}$$
Note that \(\sin\theta\) is squared — using \(\sin 30°\) once instead of twice gives 2000 m, which is option (2) and the intended trap.
From the chapter Kinematics — notes · practice set
Physics · Question 33
Two thin lenses are of same focal lengths (f), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be
- Zero
- \(\dfrac{f}{4}\)
- \(\dfrac{f}{2}\)
- Infinite
Correct option — (4) Infinite
For two thin lenses in contact, the powers add:
$$\frac{1}{f_{\text{eq}}} = \frac{1}{f_1} + \frac{1}{f_2}$$
By sign convention a convex lens has a positive focal length and a concave lens a negative one. Since their magnitudes are equal:
$$f_1 = +f, \qquad f_2 = -f$$
$$\frac{1}{f_{\text{eq}}} = \frac{1}{f} + \frac{1}{-f} = \frac{1}{f} - \frac{1}{f} = 0$$
$$f_{\text{eq}} = \infty$$
The combination has zero net power — it behaves like a plane glass slab, letting light pass without converging or diverging it. The two lenses cancel each other exactly.
Answering "zero" is the common error: \(1/f_{\text{eq}} = 0\), so \(f_{\text{eq}}\) is infinite, not zero.
From the chapter Optics — notes · practice set
Physics · Question 34
A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes \(\dfrac{u}{3}\). Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is
- 27 cm
- 24 cm
- 28 cm
- 30 cm
Correct option — (1) 27 cm
The retardation \(a\) inside the wood is uniform throughout. Use \(v^2 = u^2 - 2as\) for each stage.
Stage 1 — first 24 cm: velocity drops from \(u\) to \(u/3\).
$$\left(\frac{u}{3}\right)^2 = u^2 - 2a(24)$$
$$\frac{u^2}{9} = u^2 - 48a \;\Rightarrow\; 48a = u^2 - \frac{u^2}{9} = \frac{8u^2}{9}$$
$$a = \frac{u^2}{54} \qquad \ldots(\text{i})$$
Stage 2 — remaining distance s: velocity drops from \(u/3\) to 0.
$$0 = \left(\frac{u}{3}\right)^2 - 2as \;\Rightarrow\; 2as = \frac{u^2}{9}$$
Substituting \(a\) from (i):
$$2 \times \frac{u^2}{54} \times s = \frac{u^2}{9}$$
$$\frac{s}{27} = \frac{1}{9} \;\Rightarrow\; s = 3\ \text{cm}$$
Total length:
$$L = 24 + 3 = 27\ \text{cm}$$
Worth noticing: the bullet loses 8/9 of its kinetic energy in the first 24 cm and the remaining 1/9 in just 3 cm — energy loss is proportional to distance, so the slow final stretch is short.
From the chapter Kinematics — notes · practice set
Physics · Question 35
A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s−1. The ball strikes the water surface after 4 s. The height of bridge above water surface is (Take g = 10 m s−2)
- 56 m
- 60 m
- 64 m
- 68 m
Correct option — (3) 64 m
Take upward as positive, with the bridge as the origin. The ball starts with \(u = +4\) m s−1 and undergoes acceleration \(-g\) throughout.
Using \(s = ut - \tfrac{1}{2}gt^2\) with \(t = 4\) s:
$$s = (4)(4) - \tfrac{1}{2}(10)(4)^2$$
$$s = 16 - \tfrac{1}{2}(10)(16) = 16 - 80 = -64\ \text{m}$$
The negative sign simply means the displacement is downward from the bridge. So the water surface lies 64 m below:
$$h = 64\ \text{m}$$
The single equation handles the whole journey — upward flight, turnaround, and fall — because the acceleration never changes. There is no need to split it into separate stages.
From the chapter Kinematics — notes · practice set
Physics · Question 36
10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased n times. The value of n is
- 10
- 100
- 1
- 1000
Correct option — (2) 100
Series combination: resistances add.
$$R_{\text{eq}} = 10R \;\Rightarrow\; i = \frac{E}{10R}$$
Parallel combination: for \(n\) identical resistors the equivalent is \(R/n\).
$$R_{\text{eq}}' = \frac{R}{10} \;\Rightarrow\; i' = \frac{E}{R/10} = \frac{10E}{R}$$
Taking the ratio:
$$\frac{i'}{i} = \frac{10E/R}{E/10R} = \frac{10E}{R} \times \frac{10R}{E} = 100$$
$$n = 100$$
The factor is 100, not 10, because the change works twice over: parallel connection lowers the resistance by a factor of 10 compared to a single resistor, while series raised it by a factor of 10 — a swing of 10 × 10.
From the chapter Current Electricity — notes · practice set
Physics · Question 37
A wire carrying a current I along the positive x-axis has length L. It is kept in a magnetic field \(\vec{B} = (2\hat{i} + 3\hat{j} - 4\hat{k})\) T. The magnitude of the magnetic force acting on the wire is
- 3 IL
- \(\sqrt{5}\) IL
- 5 IL
- \(\sqrt{3}\) IL
Correct option — (3) 5 IL
Force on a current-carrying wire in a magnetic field:
$$\vec{F} = I\vec{L} \times \vec{B}$$
The wire lies along the positive \(x\)-axis, so \(\vec{L} = L\hat{i}\):
$$\vec{F} = IL\,\hat{i} \times (2\hat{i} + 3\hat{j} - 4\hat{k})$$
Evaluate term by term using \(\hat{i}\times\hat{i} = 0\), \(\hat{i}\times\hat{j} = \hat{k}\), \(\hat{i}\times\hat{k} = -\hat{j}\):
$$\vec{F} = IL\left[2(0) + 3\hat{k} - 4(-\hat{j})\right] = IL(3\hat{k} + 4\hat{j})$$
Magnitude:
$$|\vec{F}| = IL\sqrt{3^2 + 4^2} = IL\sqrt{25} = 5IL$$
The \(2\hat{i}\) component of \(\vec{B}\) contributes nothing — it is parallel to the current, and a magnetic field parallel to the current exerts no force.
From the chapter Magnetic Effects of Current — notes · practice set
Physics · Question 38
A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is the universal constant of gravitation, the quantity \(\dfrac{3\pi}{Gd}\) represents
- T
- T2
- T3
- \(\sqrt{T}\)
Correct option — (2) T2
For a satellite orbiting just above the surface, the orbital radius equals the earth's radius \(R\). From Kepler's third law:
$$T = 2\pi\sqrt{\frac{R^3}{GM}}$$
Express the mass in terms of density. Treating the earth as a uniform sphere:
$$M = d \times \frac{4}{3}\pi R^3$$
Substituting:
$$T = 2\pi\sqrt{\frac{R^3}{G \cdot d \cdot \frac{4}{3}\pi R^3}}$$
The \(R^3\) cancels completely — the period does not depend on the earth's size at all, only on its density:
$$T = 2\pi\sqrt{\frac{3}{4\pi G d}}$$
Squaring both sides:
$$T^2 = 4\pi^2 \times \frac{3}{4\pi G d} = \frac{3\pi}{Gd}$$
So \(\dfrac{3\pi}{Gd}\) represents \(T^2\).
From the chapter Gravitation — notes · practice set
Physics · Question 39
Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s−2).
- 1.2 m s−2
- 150 m s−2
- 1.5 m s−2
- 50 m s−2
Correct option — (3) 1.5 m s−2
For the body to stay put on the floor, it must accelerate along with the car. The only horizontal force available to push it forward is static friction from the floor.
Applying Newton's second law to the body:
$$f = ma$$
Static friction has an upper limit:
$$f \leq f_{\max} = \mu_s N = \mu_s mg$$
Combining, the largest acceleration the friction can sustain is
$$ma_{\max} = \mu_s mg$$
The mass cancels — the answer is independent of how heavy the body is:
$$a_{\max} = \mu_s g = 0.15 \times 10 = 1.5\ \text{m s}^{-2}$$
Beyond this, friction cannot supply the required force and the body slides backwards relative to the car.
From the chapter Laws of Motion — notes · practice set
Physics · Question 40
The resistance of platinum wire at 0°C is 2 Ω and 6.8 Ω at 80°C. The temperature coefficient of resistance of the wire is
- 3 × 10−4 °C−1
- 3 × 10−3 °C−1
- 3 × 10−2 °C−1
- 3 × 10−1 °C−1
Correct option — (3) 3 × 10−2 °C−1
Resistance varies with temperature as
$$R = R_0(1 + \alpha \Delta T)$$
where \(R_0\) is the resistance at 0°C and \(\alpha\) is the temperature coefficient.
Substituting \(R_0 = 2\ \Omega\), \(R = 6.8\ \Omega\) and \(\Delta T = 80 - 0 = 80\)°C:
$$6.8 = 2\left[1 + \alpha(80)\right]$$
$$\frac{6.8}{2} = 1 + 80\alpha \;\Rightarrow\; 3.4 = 1 + 80\alpha$$
$$80\alpha = 2.4$$
$$\alpha = \frac{2.4}{80} = 0.03 = 3 \times 10^{-2}\ °\text{C}^{-1}$$
Because the reference is 0°C, \(\Delta T\) is numerically the same in Celsius or kelvin, so no conversion is needed here.
From the chapter Current Electricity — notes · practice set
Physics · Question 41
The radius of inner most orbit of hydrogen atom is 5.3 × 10−11 m. What is the radius of third allowed orbit of hydrogen atom?
- 0.53 Å
- 1.06 Å
- 1.59 Å
- 4.77 Å
Correct option — (4) 4.77 Å
In the Bohr model the orbital radius grows as the square of the principal quantum number:
$$r_n = r_1 \times \frac{n^2}{Z}$$
For hydrogen \(Z = 1\), so \(r_n \propto n^2\).
For the third orbit, \(n = 3\):
$$r_3 = r_1 \times 3^2 = 9 r_1$$
$$r_3 = 9 \times 5.3 \times 10^{-11} = 47.7 \times 10^{-11}\ \text{m}$$
Convert to ångström using \(1\ \text{Å} = 10^{-10}\) m:
$$r_3 = 4.77 \times 10^{-10}\ \text{m} = 4.77\ \text{Å}$$
The dependence is on \(n^2\), not \(n\) — multiplying by 3 instead of 9 gives 1.59 Å, which is option (3) and the intended trap.
From the chapter Atoms and Nuclei — notes · practice set
Chemistry
Chemistry
39 questions with worked solutions · diagram-based questions omitted
Chemistry · Question 1
Which of the following reactions will NOT give primary amine as the product?
- CH3CONH2 \(\xrightarrow{\text{Br}_2/\text{KOH}}\) Product
- CH3CN \(\xrightarrow[\text{(ii) H}_3\text{O}^+]{\text{(i) LiAlH}_4}\) Product
- CH3NC \(\xrightarrow[\text{(ii) H}_3\text{O}^+]{\text{(i) LiAlH}_4}\) Product
- CH3CONH2 \(\xrightarrow[\text{(ii) H}_3\text{O}^+]{\text{(i) LiAlH}_4}\) Product
Correct option — (3) CH3NC \xrightarrow[\text{(ii) H}_3\text{O}^+]{\text{(i) LiAlH}_4} Product
Look carefully at the difference between a nitrile (CN) and an isonitrile (NC) — the point of attachment to carbon changes the product.
• Option 1: An amide with Br2/KOH is the Hoffmann bromamide degradation. It removes one carbon and gives a primary amine (CH3NH2).
• Option 2: A nitrile CH3–C≡N reduced by LiAlH4 adds hydrogens to the carbon end, giving CH3CH2NH2 — a primary amine.
• Option 4: An amide reduced by LiAlH4 also gives a primary amine.
• Option 3: An isocyanide CH3–N≡C is attached to nitrogen. On reduction the two hydrogens add to the terminal carbon, giving CH3–NH–CH3 — a secondary amine, not primary.
So option 3 is the one that does not give a primary amine.
From the chapter Amines — notes · practice set
Chemistry · Question 2
Match List-I with List-II.
List-I: (A) Coke (B) Diamond (C) Fullerene (D) Graphite
List-II: (I) Carbon atoms are sp3 hybridised (II) Used as a dry lubricant (III) Used as a reducing agent (IV) Cage like molecules
- A-II, B-IV, C-I, D-III
- A-IV, B-I, C-II, D-III
- A-III, B-I, C-IV, D-II
- A-III, B-IV, C-I, D-II
Correct option — (3) A-III, B-I, C-IV, D-II
Match each form of carbon to its defining property:
• Coke is nearly pure carbon and is widely used to reduce metal oxides to metals in metallurgy — a reducing agent (III).
• Diamond has each carbon bonded tetrahedrally to four others, so every carbon is sp3 hybridised (I).
• Fullerene (buckminsterfullerene, C60) is built from fused five- and six-membered rings that close into a hollow sphere — a cage-like molecule (IV).
• Graphite has layers that slide over one another easily, making it soft and slippery — used as a dry lubricant (II).
So A-III, B-I, C-IV, D-II.
From the chapter p-Block Elements — notes · practice set
Chemistry · Question 3
Given below are two statements: one is labelled as Assertion A and the other as Reason R.
Assertion A: Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.
Reason R: The deep blue solution is due to the formation of amide.
In the light of the above statements, choose the correct answer.
- Both A and R are true and R is the correct explanation of A
- Both A and R are true but R is NOT the correct explanation of A
- A is true but R is false
- A is false but R is true
Correct option — (3) A is true but R is false
Assertion is true. When an alkali metal like sodium dissolves in liquid ammonia, the metal releases electrons which become surrounded by ammonia molecules — these are called ammoniated electrons:
$$\text{M} + (x+y)\text{NH}_3 \rightarrow [\text{M(NH}_3)_x]^+ + [\text{e(NH}_3)_y]^-$$
These trapped electrons absorb light in the visible region, giving the deep blue colour. Because the electrons are unpaired, the solution is paramagnetic.
Reason is false. The blue colour comes from the ammoniated (solvated) electron, not from any amide. Amide formation happens only slowly and is a separate process.
So A is true but R is false.
From the chapter s-Block Elements — notes · practice set
Chemistry · Question 4
In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe3+ due to the formation of
- Fe4[Fe(CN)6]3·xH2O
- NaSCN
- [Fe(CN)5NOS]4−
- [Fe(SCN)]2+
Correct option — (4) [Fe(SCN)]2+
When both nitrogen and sulphur are present together in the organic compound, fusion with sodium produces sodium thiocyanate rather than sodium cyanide:
$$\text{Na} + \text{C} + \text{N} + \text{S} \rightarrow \text{NaSCN}$$
The thiocyanate ion then reacts with ferric ions to give a blood-red complex:
$$\text{Fe}^{3+} + \text{SCN}^- \rightarrow [\text{Fe(SCN)}]^{2+} \;\; (\text{blood red})$$
Note there is no Prussian blue here — that would require free cyanide ions, but with sulphur present the cyanide is locked up as thiocyanate. The blood-red colour is the confirmatory test for N and S together.
From the chapter Organic Chemistry Basics — notes · practice set
Chemistry · Question 5
The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm−1 cm−1 and the resistance of the cell containing the solution at 25°C is 60 ohm. The value of cell constant is
- 1.34 cm−1
- 3.28 cm−1
- 1.26 cm−1
- 3.34 cm−1
Correct option — (3) 1.26 cm−1
Conductivity, conductance and cell constant are related by
$$\kappa = G \times G^*$$
where \(\kappa\) is conductivity, \(G\) is conductance and \(G^*\) is the cell constant. Conductance is the reciprocal of resistance, \(G = 1/R\), so
$$\kappa = \frac{G^*}{R} \;\Rightarrow\; G^* = \kappa \times R$$
Substituting the values:
$$G^* = 0.0210 \times 60 = 1.26\ \text{cm}^{-1}$$
The molarity of the solution is not needed — it is extra information. The cell constant depends only on the geometry of the cell (electrode area and separation).
From the chapter Electrochemistry — notes · practice set
Chemistry · Question 6
Given below are two statements: one is labelled as Assertion A and the other as Reason R.
Assertion A: A reaction can have zero activation energy.
Reason R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer.
- Both A and R are true and R is the correct explanation of A
- Both A and R are true and R is NOT the correct explanation of A
- A is true but R is false
- A is false but R is true
Correct option — (2) Both A and R are true and R is NOT the correct explanation of A
Assertion is true. A few reactions — certain radical combination reactions, for example — proceed with essentially no energy barrier, so their activation energy is effectively zero.
Reason is true. Activation energy is correctly defined as the minimum extra energy that reactant molecules must absorb for their energy to reach the threshold value needed to react.
But R does not explain A. The definition of activation energy tells you what it is; it says nothing about why a particular reaction could have that value equal to zero. The two statements are both correct but independent.
So both are true, R is not the correct explanation of A.
From the chapter Chemical Kinetics — notes · practice set
Chemistry · Question 7
Which one is an example of heterogenous catalysis?
- Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen
- Hydrolysis of sugar catalysed by H+ ions
- Decomposition of ozone in presence of nitrogen monoxide
- Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron
Correct option — (4) Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron
The distinction is about phases: heterogeneous catalysis has the catalyst in a different phase from the reactants; homogeneous catalysis has them in the same phase.
• Option 4 is the Haber process:
$$\text{N}_2(g) + 3\text{H}_2(g) \xrightarrow{\text{Fe}(s)} 2\text{NH}_3(g)$$
The iron catalyst is a solid while the reactants are gases — different phases, so this is heterogeneous.
The other three are all homogeneous — catalyst and reactants share the same phase:
• SO2 oxidation with gaseous NO — all gases.
• Sugar hydrolysis with H+ — all in aqueous solution.
• Ozone decomposition with NO — all gases.
So option 4 is the heterogeneous case.
From the chapter Surface Chemistry — notes · practice set
Chemistry · Question 8
The given compound
C6H5–CH=CH–CH(X)–CH2–CH3
(a phenyl group attached to CH=CH–CHX–CH2–CH3) is an example of ______.
- Benzylic halide
- Aryl halide
- Allylic halide
- Vinylic halide
Correct option — (3) Allylic halide
The classification depends on what kind of carbon bears the halogen X.
Here X sits on a carbon that is sp3 hybridised and is directly attached to a carbon–carbon double bond (C=C). A saturated carbon adjacent to a double bond is called an allylic position, so this is an allylic halide.
Ruling out the others:
• Vinylic halide would need X directly on a doubly-bonded (sp2) carbon — it is not.
• Aryl halide would need X directly on the benzene ring — it is not.
• Benzylic halide would need X on the carbon directly attached to the ring — here that carbon is part of the C=C, and X is one carbon further along.
So it is an allylic halide.
From the chapter Haloalkanes and Haloarenes — notes · practice set
Chemistry · Question 9
Given below are two statements: one is labelled as Assertion A and the other as Reason R.
Assertion A: Helium is used to dilute oxygen in diving apparatus.
Reason R: Helium has high solubility in O2.
- Both A and R are true and R correct explanation of A
- Both A and R are true and R is NOT the correct explanation of A
- A is true but R is false
- A is false but R is true
Correct option — (2) Both A and R are true and R is NOT the correct explanation of A
Chemically ambiguous. The official NTA/coaching key marks option (2) — both true, R not the correct explanation. Strictly, the reason's wording is questionable, since helium is used for its LOW solubility in blood. Follow the official key for marking.
Assertion is true. Divers breathe a helium–oxygen mixture instead of nitrogen–oxygen. Helium's very low solubility in blood means it does not dissolve into the bloodstream under the high pressures at depth, avoiding the dangerous bubbles ("the bends") that nitrogen would form on ascent.
On the reason: the official key treats R as true (helium and oxygen mix/diffuse readily), giving option 2 — both true, but R not the correct explanation of the assertion. Note, however, that the reason as worded ("high solubility in O2") is chemically loose: helium is chosen for its low solubility in blood, not a high solubility. Go with the official answer (option 2) for the exam, but understand the underlying chemistry is about low blood solubility.
From the chapter p-Block Elements — notes · practice set
Chemistry · Question 10
A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is AxBy, then the value of x + y is
- 5
- 4
- 3
- 2
Correct option — (1) 5
Start by counting the atoms and voids in a close-packed lattice.
Let there be \(N\) atoms of B forming the ccp arrangement. In any close-packed structure the number of tetrahedral voids is twice the number of packing atoms, so there are \(2N\) tetrahedral voids.
Atoms of A fill 1/3 of these voids:
$$\text{A} = \frac{1}{3} \times 2N = \frac{2N}{3}$$
The ratio A : B is therefore
$$\frac{2N/3}{N} = \frac{2}{3}$$
giving the formula
$$\text{A}_2\text{B}_3$$
So \(x = 2\), \(y = 3\), and
$$x + y = 5$$
From the chapter Solid State — notes · practice set
Chemistry · Question 11
Given below are two statements:
Statement I: A unit formed by the attachment of a base to 1′ position of sugar is known as nucleoside.
Statement II: When nucleoside is linked to phosphorous acid at 5′-position of sugar moiety, we get nucleotide.
In the light of the above statements, choose the correct answer.
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is true but Statement II is false
- Statement I is false but Statement II is true
Correct option — (3) Statement I is true but Statement II is false
Statement I is true. A nucleoside is exactly this: a nitrogenous base joined to the 1′ carbon of the sugar. (The sugar carbons are numbered 1′, 2′, 3′... with primes to distinguish them from the atoms in the base.)
Statement II is false because of one word. A nucleotide is formed when the nucleoside is linked to phosphoric acid at the 5′ position — not phosphorous acid. Phosphoric acid (H3PO4) and phosphorous acid (H3PO3) are different compounds, and it is the phosphate (from phosphoric acid) that forms the backbone of DNA and RNA.
So Statement I is true but Statement II is false.
From the chapter Biomolecules — notes · practice set
Chemistry · Question 12
The relation between nm (nm = the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l), is
- \(l = \dfrac{n_m - 1}{2}\)
- \(l = 2n_m + 1\)
- \(n_m = 2l^2 + 1\)
- \(n_m = l + 2\)
Correct option — (1) l = \dfrac{n_m - 1}{2}
For a given azimuthal quantum number \(l\), the magnetic quantum number \(m\) runs over all integers from \(-l\) to \(+l\), including zero:
$$m = -l, \ldots, -1, 0, +1, \ldots, +l$$
Counting these values gives
$$n_m = 2l + 1$$
The question asks for \(l\) in terms of \(n_m\), so rearrange:
$$2l = n_m - 1 \;\Rightarrow\; l = \frac{n_m - 1}{2}$$
That is option (1). For example, for a d-subshell \(l = 2\), so \(n_m = 5\) (the five d-orbitals), and indeed \(l = (5-1)/2 = 2\).
From the chapter Atomic Structure — notes · practice set
Chemistry · Question 13
Amongst the following the total number of species NOT having eight electrons around central atom in its outermost shell, is
NH3, AlCl3, BeCl2, CCl4, PCl5
- 3
- 2
- 4
- 1
Correct option — (1) 3
Count the electrons around the central atom in each — the octet rule is satisfied when there are exactly eight.
• NH3: nitrogen has three bond pairs and one lone pair = 8 electrons. Octet complete.
• AlCl3: aluminium forms three bonds = 6 electrons. Short of octet.
• BeCl2: beryllium forms two bonds = 4 electrons. Short of octet.
• CCl4: carbon forms four bonds = 8 electrons. Octet complete.
• PCl5: phosphorus forms five bonds = 10 electrons. Expanded octet.
Three species — AlCl3, BeCl2 and PCl5 — do not have exactly eight electrons around the central atom.
So the answer is 3.
From the chapter Chemical Bonding — notes · practice set
Chemistry · Question 14
The correct order of energies of molecular orbitals of N2 molecule, is
- σ1s < σ*1s < σ2s < σ*2s < (π2px = π2py) < σ2pz < (π*2px = π*2py) < σ*2pz
- σ1s < σ*1s < σ2s < σ*2s < σ2pz < (π2px = π2py) < (π*2px = π*2py) < σ*2pz
- σ1s < σ*1s < σ2s < σ*2s < σ2pz < σ*2pz < (π2px = π2py) < (π*2px = π*2py)
- σ1s < σ*1s < σ2s < σ*2s < (π2px = π2py) < (π*2px = π*2py) < σ2pz < σ*2pz
Correct option — (1) σ1s < σ*1s < σ2s < σ*2s < (π2px = π2py) < σ2pz < (π*2px = π*2py) < σ*2pz
For the lighter second-period molecules — B2, C2 and N2 — there is significant s–p mixing, which pushes the σ2pz orbital above the π2p orbitals. This gives the order:
$$\sigma 1s < \sigma^*1s < \sigma 2s < \sigma^*2s < (\pi 2p_x = \pi 2p_y) < \sigma 2p_z < (\pi^*2p_x = \pi^*2p_y) < \sigma^*2p_z$$
The key feature to remember: for N2 and lighter, the two π bonding orbitals come before the σ2pz. Only from O2 onwards does the σ2pz drop below the π orbitals (that is what option 2 describes, which is wrong for N2).
So option 1 is correct.
From the chapter Chemical Bonding — notes · practice set
Chemistry · Question 15
The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are:
- 11, 2, 0
- 12, 3, 0
- 11, 3, 1
- 12, 2, 1
Correct option — (3) 11, 3, 1
Pyridine is a six-membered aromatic ring, C5H5N, with one nitrogen replacing a CH group of benzene.
Sigma bonds: The ring has 6 C–C/C–N sigma bonds around it. Five carbons each carry one hydrogen, adding 5 C–H sigma bonds. Total = 6 + 5 = 11 sigma bonds.
Pi bonds: Like benzene, pyridine has three alternating double bonds in the ring, contributing 3 pi bonds.
Lone pairs: The nitrogen has one lone pair — and importantly this lone pair lies in an sp2 orbital in the plane of the ring, not in the aromatic π system, which is why pyridine is basic. That is 1 lone pair.
So 11, 3, 1.
From the chapter Chemical Bonding — notes · practice set
Chemistry · Question 16
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include:
(A) dipole-dipole forces (B) dipole-induced dipole forces (C) hydrogen bonding (D) covalent bonding (E) dispersion forces
- B, C, D, E are correct
- A, B, C, D are correct
- A, B, C, E are correct
- A, C, D, E are correct
Correct option — (3) A, B, C, E are correct
Intermolecular forces act between molecules. The key is to spot the one item that is an intramolecular force.
Covalent bonding (D) is the force that holds atoms together within a single molecule — it is a chemical bond, not an intermolecular force. So D must be excluded.
The genuine intermolecular forces (all van der Waals type or hydrogen bonding) are:
• A dipole–dipole forces
• B dipole–induced dipole forces
• C hydrogen bonding
• E dispersion (London) forces
So the correct set is A, B, C, E.
From the chapter States of Matter — notes · practice set
Chemistry · Question 17
Which of the following statements are NOT correct?
(A) Hydrogen is used to reduce heavy metal oxides to metals.
(B) Heavy water is used to study reaction mechanism.
(C) Hydrogen is used to make saturated fats from oils.
(D) The H–H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any elements.
(E) Hydrogen reduces oxides of metals that are more active than iron.
- B, C, D, E only
- B, D only
- D, E only
- A, B, C only
Correct option — (3) D, E only
Check each statement for correctness — the question asks which are wrong.
Correct statements: (A) hydrogen does reduce heavy metal oxides to metals; (B) heavy water (D2O) is used to trace reaction mechanisms; (C) hydrogenation of oils produces saturated fats (vanaspati).
The two incorrect statements:
• (D) is wrong. The H–H bond enthalpy is actually the highest — not lowest — among single bonds between two atoms of any element (about 435 kJ/mol), because the tiny hydrogen atoms allow very close, strong overlap.
• (E) is wrong. Hydrogen can only reduce oxides of metals that are less active than iron (that lie below it in the reactivity series). Oxides of metals more active than iron cannot be reduced by hydrogen.
So D and E are the incorrect statements.
From the chapter Hydrogen — notes · practice set
Chemistry · Question 18
Which amongst the following molecules on polymerization produces neoprene?
- H2C=CH–CH=CH2
- H2C=C(Cl)–CH=CH2
- H2C=CH–C≡CH
- H2C=C(CH3)–CH=CH2
Correct option — (2) H2C=C(Cl)–CH=CH2
Neoprene is a synthetic rubber made by the free-radical polymerisation of chloroprene (2-chloro-1,3-butadiene):
$$n\,\text{CH}_2{=}\text{C(Cl)}{-}\text{CH}{=}\text{CH}_2 \xrightarrow{\text{polymerisation}} [{-}\text{CH}_2{-}\text{C(Cl)}{=}\text{CH}{-}\text{CH}_2{-}]_n$$
The monomer is a butadiene skeleton carrying a chlorine on the second carbon — that is option 2.
The others give different polymers: option 1 (buta-1,3-diene) gives Buna rubber, and option 4 (isoprene, with a methyl group instead of chlorine) gives natural rubber. Neoprene needs the chlorine, which is what makes it oil- and weather-resistant.
From the chapter Polymers — notes · practice set
Chemistry · Question 19
Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
- Chlordiazepoxide
- Meprobamate
- Valium
- Veronal
Correct option — (4) Veronal
Barbiturates are a specific class of tranquilizers derived from barbituric acid.
Among the options, Veronal (also called barbital) is a derivative of barbituric acid and is therefore a barbiturate.
The other three — chlordiazepoxide, meprobamate and valium — are also tranquilizers but belong to different chemical classes (the first and third are benzodiazepines), not barbiturates.
So the answer is Veronal.
From the chapter Chemistry in Everyday Life — notes · practice set
Chemistry · Question 20
The element expected to form largest ion to achieve the nearest noble gas configuration is
- O
- F
- N
- Na
Correct option — (3) N
To reach the nearest noble gas (neon) configuration, each of these gains or loses electrons to become isoelectronic — all end up with 10 electrons:
• O → O2− (gains 2)
• F → F− (gains 1)
• N → N3− (gains 3)
• Na → Na+ (loses 1)
For an isoelectronic series, the ionic size depends on the nuclear charge pulling on those 10 electrons: fewer protons means a weaker pull and a larger ion. The order of nuclear charge is Na(11) > O(8) > F(9)... wait, arrange by protons: N has only 7 protons, the fewest of the four.
With the smallest nuclear charge holding the 10 electrons, N3− has the largest ionic radius. Also, as the negative charge on an anion increases, the ion swells — and N3− carries the highest negative charge here.
So nitrogen forms the largest ion.
From the chapter Periodic Classification — notes · practice set
Chemistry · Question 21
Select the correct statements from the following:
(A) Atoms of all elements are composed of two fundamental particles.
(B) The mass of the electron is 9.10939 × 10−31 kg.
(C) All the isotopes of a given element show same chemical properties.
(D) Protons and electrons are collectively known as nucleons.
(E) Dalton's atomic theory regarded the atom as an ultimate particle of matter.
- A, B and C only
- C, D and E only
- A and E only
- B, C and E only
Correct option — (4) B, C and E only
Test each statement:
• (A) Wrong. Atoms are made of three fundamental particles — electrons, protons and neutrons — not two.
• (B) Correct. The electron mass is indeed 9.10939 × 10−31 kg.
• (C) Correct. Isotopes differ only in neutron number, so they have the same electronic configuration and hence identical chemical properties.
• (D) Wrong. Nucleons are the particles in the nucleus — protons and neutrons, not protons and electrons.
• (E) Correct. Dalton's theory treated the atom as the ultimate, indivisible particle of matter.
So the correct statements are B, C and E only.
From the chapter Atomic Structure — notes · practice set
Chemistry · Question 22
The stability of Cu2+ is more than Cu+ salts in aqueous solution due to
- First ionisation enthalpy
- Enthalpy of atomization
- Hydration energy
- Second ionisation enthalpy
Correct option — (3) Hydration energy
At first glance Cu+ should be favoured, because forming Cu2+ requires the large second ionisation enthalpy. So why is Cu2+ more stable in water?
The answer is the hydration energy. The Cu2+ ion is smaller and doubly charged, so it attracts water molecules far more strongly than the singly-charged Cu+. Its hydration enthalpy is very large and negative (about −2121 kJ/mol).
This enormous release of energy on hydration more than compensates for the extra second ionisation enthalpy needed to reach Cu2+. On balance, Cu2+(aq) sits lower in energy and is the more stable species in aqueous solution.
So the answer is hydration energy.
From the chapter d- and f-Block Elements — notes · practice set
Chemistry · Question 23
Which one of the following statements is correct?
- The daily requirement of Mg and Ca in the human body is estimated to be 0.2-0.3 g
- All enzymes that utilise ATP in phosphate transfer require Ca as the cofactor
- The bone in human body is an inert and unchanging substance
- Mg plays roles in neuromuscular function and interneuronal transmission
Correct option — (1) The daily requirement of Mg and Ca in the human body is estimated to be 0.2-0.3 g
Check each biological statement:
• Option 1 — correct. The daily requirement of both Mg and Ca is around 200–300 mg, which is 0.2–0.3 g.
• Option 2 — wrong. Enzymes using ATP in phosphate transfer require Mg as the cofactor, not Ca.
• Option 3 — wrong. Bone is not inert; it is constantly being dissolved and redeposited throughout life.
• Option 4 — wrong. It is Ca, not Mg, that plays the key role in neuromuscular function, interneuronal transmission, cell membrane integrity and blood clotting.
So only option 1 is correct.
From the chapter s-Block Elements — notes · practice set
Chemistry · Question 24
Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is:
- 16
- 32
- 30
- 18
Correct option — (2) 32
This is soda-lime decarboxylation (decarboxylation of a carboxylate salt with NaOH/CaO). Heating sodium ethanoate removes the –COO− group as carbonate and gives methane:
$$\text{CH}_3\text{COONa} \xrightarrow[\text{CaO}]{\text{NaOH}} \text{CH}_4 + \text{Na}_2\text{CO}_3$$
So the organic product is methane, CH4.
Molar mass of CH4 = 12 + 4(1) = 16 g/mol.
Weight of 2 moles:
$$2 \times 16 = 32\ \text{g}$$
From the chapter Aldehydes, Ketones and Acids — notes · practice set
Chemistry · Question 25
Amongst the given options which of the following molecules/ion acts as a Lewis acid?
- NH3
- H2O
- BF3
- OH−
Correct option — (3) BF3
A Lewis acid accepts a lone pair of electrons — it needs an empty orbital in its valence shell to receive that pair.
• BF3: boron has only six electrons around it (three B–F bonds) and an empty p-orbital. It readily accepts a lone pair, so it is a Lewis acid.
The others are all electron-pair donors, hence Lewis bases:
• NH3 has a lone pair on nitrogen.
• H2O has lone pairs on oxygen.
• OH− has lone pairs and a negative charge to donate.
So BF3 is the Lewis acid.
From the chapter Chemical Bonding — notes · practice set
Chemistry · Question 26
Taking stability as the factor, which one of the following represents correct relationship?
- TlCl3 > TlCl
- InI3 > InI
- AlCl > AlCl3
- TlI > TlI3
Correct option — (4) TlI > TlI3
This is about the inert pair effect. Going down group 13 (Al → In → Tl), the +1 oxidation state becomes progressively more stable relative to +3, because the ns2 electrons become reluctant to take part in bonding.
For thallium, the heaviest element here, the +1 state is much more stable than +3. This is reflected in the reduction potentials:
$$E° \text{ for Tl}^{3+}/\text{Tl}^+ = +1.6\ \text{V (strongly oxidising)}$$
meaning Tl3+ readily drops to Tl+.
So TlI (Tl+) is more stable than TlI3 (Tl3+) — option 4.
The other options are all backwards: for Al and In the +3 state is generally the stable one, so TlCl3 > TlCl and InI3 > InI would only hold for lighter elements, and AlCl (Al+) is not more stable than AlCl3.
From the chapter p-Block Elements — notes · practice set
Chemistry · Question 27
Homoleptic complex from the following complexes is
- Potassium trioxalatoaluminate (III)
- Diamminechloridonitrito-N-platinum (II)
- Pentaamminecarbonatocobalt (III) chloride
- Triamminetriaquachromium (III) chloride
Correct option — (1) Potassium trioxalatoaluminate (III)
A homoleptic complex is one in which the metal is bonded to only one kind of ligand. (A heteroleptic complex has more than one kind.)
• Potassium trioxalatoaluminate(III), K3[Al(ox)3]: the aluminium is surrounded only by oxalate ligands — a single type. This is homoleptic.
The others each mix ligand types:
• Diamminechloridonitrito-Pt(II): has ammine, chlorido and nitrito ligands.
• Pentaamminecarbonatocobalt(III): has ammine and carbonato ligands.
• Triamminetriaquachromium(III): has ammine and aqua ligands.
So the homoleptic complex is potassium trioxalatoaluminate(III).
From the chapter Coordination Compounds — notes · practice set
Chemistry · Question 28
Which amongst the following options are correct graphical representation of Boyle's law? (Graphs of P versus 1/V at three temperatures T3 > T2 > T1 are shown; the correct one is a set of straight lines through the origin.)
- P vs V curves (hyperbolae)
- P vs 1/V straight lines through origin, T₃ steepest
- P vs 1/V curves
- P vs T straight lines
Correct option — (2) P vs 1/V straight lines through origin, T₃ steepest
Boyle's law says that at constant temperature, pressure and volume are inversely related. Starting from the ideal gas equation at fixed \(n\) and \(T\):
$$PV = nRT \;\Rightarrow\; P = nRT\left(\frac{1}{V}\right)$$
This has the form \(P = (\text{constant}) \times \frac{1}{V}\), which is a straight line through the origin when P is plotted against 1/V.
The slope of that line is \(nRT\), so a higher temperature gives a steeper line. That is why the line for T3 (the highest temperature) is the steepest.
So the correct graph is the set of straight lines through the origin with T3 steepest — option 2. (A plot of P versus V directly would give a hyperbola, not a straight line.)
From the chapter States of Matter — notes · practice set
Chemistry · Question 29
The right option for the mass of CO2 produced by heating 20 g of 20% pure limestone is (Atomic mass of Ca = 40) [CaCO3 \(\xrightarrow{1200\,\text{K}}\) CaO + CO2]
- 1.12 g
- 1.76 g
- 2.64 g
- 1.32 g
Correct option — (2) 1.76 g
Step 1 — find the mass of pure CaCO3.
The limestone is only 20% pure:
$$\text{pure CaCO}_3 = 20 \times \frac{20}{100} = 4\ \text{g}$$
Step 2 — use the stoichiometry. The molar masses are CaCO3 = 40 + 12 + 48 = 100 g/mol and CO2 = 44 g/mol. The equation shows 1 mol CaCO3 gives 1 mol CO2, so:
$$100\ \text{g CaCO}_3 \rightarrow 44\ \text{g CO}_2$$
Step 3 — scale to 4 g.
$$4\ \text{g CaCO}_3 \rightarrow \frac{44}{100} \times 4 = 1.76\ \text{g CO}_2$$
The trap is forgetting the 20% purity and working with the full 20 g.
From the chapter Basic Concepts of Chemistry — notes · practice set
Chemistry · Question 30
For a certain reaction, the rate = k[A]2[B], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would
- Decrease by a factor of nine
- Increase by a factor of six
- Increase by a factor of nine
- Increase by a factor of three
Correct option — (3) Increase by a factor of nine
The rate law is
$$r = k[\text{A}]^2[\text{B}]$$
A is second order, so its concentration enters as a square. Tripling [A] while holding [B] fixed:
$$r' = k[3\text{A}]^2[\text{B}] = k \cdot 9[\text{A}]^2[\text{B}] = 9\,r$$
The rate increases by a factor of nine, because \(3^2 = 9\).
The common error is answering "three" by treating A as first order — but the exponent 2 makes the effect the square of the concentration change.
From the chapter Chemical Kinetics — notes · practice set
Chemistry · Question 31
Given below are two statements: one is labelled as Assertion A and the other as Reason R.
Assertion A: In equation ΔrG = −nFEcell, value of ΔrG depends on n.
Reason R: Ecell is an intensive property and ΔrG is an extensive property.
- Both A and R are true and R is the correct explanation of A
- Both A and R are true and R is NOT the correct explanation of A
- A is true but R is false
- A is false but R is true
Correct option — (2) Both A and R are true and R is NOT the correct explanation of A
Assertion is true. In \(\Delta_r G = -nFE_{\text{cell}}\), the factor \(n\) is the number of moles of electrons transferred. Since \(n\) appears directly, \(\Delta_r G\) scales with it.
Reason is true. \(E_{\text{cell}}\) is an intensive property — it does not depend on the amount of substance (doubling the cell size does not change the voltage). But \(\Delta_r G\) is an extensive property — it does depend on how much reaction occurs.
Does R explain A? Not really. The assertion is simply that \(\Delta_r G\) contains \(n\), which follows from the equation itself. The reason correctly classifies the two quantities but that classification isn't what makes \(\Delta_r G\) depend on \(n\) in the formula. Both statements are true but independent.
So both true, R not the correct explanation.
From the chapter Electrochemistry — notes · practice set
Chemistry · Question 32
Which of the following statements are INCORRECT?
(A) All the transition metals except scandium form MO oxides which are ionic.
(B) The highest oxidation number corresponding to the group number in transition metal oxides is attained in Sc2O3 to Mn2O7.
(C) Basic character increases from V2O3 to V2O4 to V2O5.
(D) V2O4 dissolves in acids to give VO43− salts.
(E) CrO is basic but Cr2O3 is amphoteric.
- A and E only
- B and D only
- C and D only
- B and C only
Correct option — (3) C and D only
The question asks for the incorrect statements.
• (C) is incorrect. As the oxidation state of vanadium rises from V2O3 → V2O4 → V2O5, the oxides become more acidic, not more basic. Higher oxidation state = more acidic oxide.
• (D) is incorrect. V2O4 dissolves in acid to give the VO2+ (vanadyl) ion, not the VO43− ion (which is a V(V) species).
The correct statements are A, B and E: transition metals except Sc form ionic MO oxides; the group-number oxidation state runs from Sc2O3 to Mn2O7; and CrO (low oxidation state) is basic while Cr2O3 is amphoteric.
So the incorrect ones are C and D.
From the chapter d- and f-Block Elements — notes · practice set
Chemistry · Question 33
Which complex compound is most stable?
- [Co(NH3)4(H2O)Br](NO3)2
- [Co(NH3)3(NO3)3]
- [CoCl2(en)2]NO3
- [Co(NH3)6]2(SO4)3
Correct option — (3) [CoCl2(en)2]NO3
The stability of a complex is greatly enhanced by the chelate effect: complexes with polydentate (chelating) ligands are much more stable than those with only monodentate ligands.
Looking at the options, only [CoCl2(en)2]NO3 contains a chelating ligand — ethylenediamine (en) is bidentate, gripping the metal at two points and forming stable five-membered rings.
The other complexes use only monodentate ligands (NH3, H2O, Br−, NO3−), so they lack this extra chelate stabilisation.
So the most stable is [CoCl2(en)2]NO3.
From the chapter Coordination Compounds — notes · practice set
Chemistry · Question 34
What fraction of one edge centred octahedral void lies in one unit cell of fcc?
- 1/2
- 1/3
- 1/4
- 1/12
Correct option — (3) 1/4
In a face-centred cubic (fcc) unit cell, octahedral voids sit at two kinds of positions: the body centre and the edge centres.
An edge is shared between 4 unit cells that meet along it. So any void sitting at the centre of an edge is split among those 4 cells, and only
$$\frac{1}{4}$$
of it belongs to any one unit cell.
(For completeness: there are 12 edges, each contributing 1/4, giving 12 × 1/4 = 3 voids from edges, plus 1 at the body centre = 4 octahedral voids per fcc cell, matching the 4 atoms per cell.)
So the fraction is 1/4.
From the chapter Solid State — notes · practice set
Chemistry · Question 35
Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
- ΔH = ΔU − ΔngRT
- ΔH = ΔU + ΔngRT
- ΔH − ΔU = −ΔnRT
- ΔH + ΔU = ΔnR
Correct option — (2) ΔH = ΔU + ΔngRT
Enthalpy is defined as \(H = U + PV\). For a reaction at constant temperature and pressure, the change is
$$\Delta H = \Delta U + \Delta(PV)$$
For gaseous reactants and products treated as ideal, \(PV = nRT\), so at constant T the change in the \(PV\) term comes entirely from the change in the number of moles of gas:
$$\Delta(PV) = \Delta n_g RT$$
where \(\Delta n_g\) = (moles of gaseous products) − (moles of gaseous reactants). Therefore:
$$\Delta H = \Delta U + \Delta n_g RT$$
That is option 2. The subscript g is important — only gaseous species count, since the volume change of solids and liquids is negligible.
From the chapter Chemical Thermodynamics — notes · practice set
Chemistry · Question 36
On balancing the given redox reaction,
aCr2O72− + bSO32−(aq) + cH+(aq) → 2aCr3+(aq) + bSO42−(aq) + (c/2)H2O(l)
the coefficients a, b and c are found to be, respectively
- 1, 3, 8
- 3, 8, 1
- 1, 8, 3
- 8, 1, 3
Correct option — (1) 1, 3, 8
Balance by the ion-electron (half-reaction) method.
Reduction half: chromium goes from +6 to +3, gaining electrons:
$$\text{Cr}_2\text{O}_7^{2-} + 14\text{H}^+ + 6e^- \rightarrow 2\text{Cr}^{3+} + 7\text{H}_2\text{O}$$
Oxidation half: sulphur goes from +4 to +6, losing 2 electrons; multiply by 3 to balance the 6 electrons:
$$3\,\text{SO}_3^{2-} \rightarrow 3\,\text{SO}_4^{2-} + 6e^-$$
Add them: the electrons cancel, giving
$$\text{Cr}_2\text{O}_7^{2-} + 3\text{SO}_3^{2-} + 8\text{H}^+ \rightarrow 2\text{Cr}^{3+} + 3\text{SO}_4^{2-} + 4\text{H}_2\text{O}$$
Reading off the coefficients: a = 1, b = 3, c = 8.
So 1, 3, 8.
From the chapter Redox Reactions — notes · practice set
Chemistry · Question 37
The equilibrium concentrations of the species in the reaction A + B ⇌ C + D are 2, 3, 10 and 6 mol L−1, respectively at 300 K. ΔG° for the reaction is (R = 2 cal/mol K)
- 1372.60 cal
- −137.26 cal
- −1381.80 cal
- −13.73 cal
Correct option — (3) −1381.80 cal
Step 1 — find the equilibrium constant.
$$K = \frac{[\text{C}][\text{D}]}{[\text{A}][\text{B}]} = \frac{10 \times 6}{2 \times 3} = \frac{60}{6} = 10$$
Step 2 — apply the free energy relation.
$$\Delta G° = -RT \ln K = -2.303\,RT \log K$$
Substituting R = 2 cal/mol·K, T = 300 K, log 10 = 1:
$$\Delta G° = -2.303 \times 2 \times 300 \times 1$$
$$\Delta G° = -1381.8\ \text{cal}$$
The negative sign confirms the forward reaction is spontaneous, consistent with K > 1.
From the chapter Equilibrium — notes · practice set
Chemistry · Question 38
Pumice stone is an example of
- Sol
- Gel
- Solid sol
- Foam
Correct option — (3) Solid sol
A colloid is classified by which phase is dispersed in which. Pumice stone is a light, porous volcanic rock full of trapped gas bubbles frozen into solid rock.
• Dispersed phase: gas (the bubbles)
• Dispersing medium: solid (the rock)
A gas dispersed in a solid is called a solid sol (also called solid foam).
Contrast with the others: a sol is solid-in-liquid, a gel is liquid-in-solid, and a foam is gas-in-liquid. Since here the gas is trapped in a solid matrix, pumice is a solid sol.
From the chapter Surface Chemistry — notes · practice set
Chemistry · Question 39
The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is:
- Fe2O3 + CO → 2FeO + CO2
- FeO + CO → Fe + CO2
- C + CO2 → 2CO
- CaO + SiO2 → CaSiO3
Correct option — (1) Fe2O3 + CO → 2FeO + CO2
The blast furnace has a temperature gradient, and different reactions occur in different zones.
In the higher temperature zone (900–1500 K), these take place:
• \(\text{C} + \text{CO}_2 \rightarrow 2\text{CO}\) — regeneration of the reducing gas.
• \(\text{FeO} + \text{CO} \rightarrow \text{Fe} + \text{CO}_2\) — final reduction to iron.
• \(\text{CaO} + \text{SiO}_2 \rightarrow \text{CaSiO}_3\) — slag formation, removing the silica impurity.
The reaction \(\text{Fe}_2\text{O}_3 + \text{CO} \rightarrow 2\text{FeO} + \text{CO}_2\) is the first reduction step and happens in the cooler upper zone at about 500–800 K, not in the 900–1500 K range.
So option 1 is the reaction that does NOT take place in this temperature range.
From the chapter Metallurgy — notes · practice set
Botany
Botany
38 questions with worked solutions · diagram-based questions omitted
Botany · Question 1
Given below are two statements: one labelled as Assertion A and the other labelled as Reason R.
Assertion A: The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R: Protonema develops directly from spores produced in capsule.
- Both A and R are correct and R is the correct explanation of A
- Both A and R are correct but R is NOT the correct explanation of A
- A is correct but R is not correct
- A is not correct but R is correct
Correct option — (1) Both A and R are correct and R is the correct explanation of A
The dominant phase in a moss life cycle is the gametophyte, and it develops in two stages. The first stage is the protonema — a creeping, green, branched filament — which grows directly from a germinating spore. The spores themselves are produced inside the capsule of the sporophyte.
So the assertion (protonema is the first gametophyte stage) is correct, and the reason (protonema develops directly from spores in the capsule) is also correct and properly explains how that first stage arises.
So both are correct and R is the correct explanation of A.
From the chapter Plant Kingdom — notes · practice set
Botany · Question 2
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are:
- Synergids, Primary endosperm nucleus and zygote
- Antipodals, synergids, and primary endosperm nucleus
- Synergids, Zygote and Primary endosperm nucleus
- Synergids, antipodals and Polar nuclei
Correct option — (3) Synergids, Zygote and Primary endosperm nucleus
Match each structure to its ploidy level:
• Haploid (n): the synergids are cells of the female gametophyte, formed by mitosis of a haploid megaspore — so they are haploid.
• Diploid (2n): the zygote forms when one haploid male gamete fuses with the haploid egg (n + n = 2n).
• Triploid (3n): the primary endosperm nucleus forms when the second male gamete fuses with the diploid secondary nucleus (n + 2n = 3n) — this is the essence of double fertilisation.
So the sequence haploid → diploid → triploid is synergids → zygote → primary endosperm nucleus.
From the chapter Sexual Reproduction in Flowering Plants — notes · practice set
Botany · Question 3
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
- Osmosis
- Facilitated Diffusion
- Passive Transport
- Active Transport
Correct option — (4) Active Transport
Moving a substance against its concentration gradient — from low concentration to high — is not spontaneous. It requires an input of energy.
Active transport is precisely this: it uses metabolic energy (ATP) via membrane pump proteins to push ions uphill, against the gradient, allowing them to accumulate on one side.
The others cannot do this:
• Osmosis, facilitated diffusion and passive transport all move substances down their gradient (high to low) and require no energy.
So the answer is active transport.
From the chapter Transport in Plants — notes · practice set
Botany · Question 4
Large, colourful, fragrant flowers with nectar are seen in
- Insect pollinated plants
- Bird pollinated plants
- Bat pollinated plants
- Wind pollinated plants
Correct option — (1) Insect pollinated plants
Flowers advertise to their pollinators, and the advertisement matches the pollinator's senses.
Being large, colourful, fragrant, and offering nectar as a reward, is the classic signature of flowers pollinated by insects (entomophily). The bright colours and scent attract insects visually and by smell, and nectar rewards their visits.
By contrast:
• Wind-pollinated flowers are small, dull and scentless — they invest in pollen, not petals.
• Bird and bat flowers have their own patterns (often red for birds, night-opening for bats), but the specific combination of colour + fragrance + nectar described here points to insects.
So the answer is insect pollinated plants.
From the chapter Sexual Reproduction in Flowering Plants — notes · practice set
Botany · Question 5
The phenomenon of pleiotropism refers to
- Presence of several alleles of a single gene controlling a single crossover
- Presence of two alleles, each of the two genes controlling a single trait
- A single gene affecting multiple phenotypic expression
- More than two genes affecting a single character
Correct option — (3) A single gene affecting multiple phenotypic expression
Break down the word: pleio- means many, -tropism refers to effects. So pleiotropy is one gene producing many effects — a single gene influencing several, seemingly unrelated, phenotypic characters.
A classic example is the gene for phenylketonuria (PKU), where a single mutation affects mental development, skin pigmentation and hair colour all at once.
Distinguish this from the reverse case: when many genes affect a single character (option 4), that is polygenic inheritance, not pleiotropy.
So pleiotropy is a single gene affecting multiple phenotypic expressions.
From the chapter Principles of Inheritance and Variation — notes · practice set
Botany · Question 6
Which hormone promotes internode/petiole elongation in deep water rice?
- GA3
- Kinetin
- Ethylene
- 2,4-D
Correct option — (3) Ethylene
Deep-water rice faces a specific survival problem: when floodwaters rise, the plant must grow taller quickly to keep its leaves above water or it will drown.
The hormone responsible is ethylene. As the plant becomes submerged, ethylene accumulates and triggers rapid elongation of the internodes and petioles, pushing the shoot above the water surface.
This is a well-known adaptive response — ethylene is usually associated with fruit ripening and senescence, but in deep-water rice it drives this dramatic upward growth.
So the answer is ethylene.
From the chapter Plant Growth and Development — notes · practice set
Botany · Question 7
Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?
- Habitat loss and fragmentation
- Over exploitation for economic gain
- Alien species invasions
- Co-extinctions
Correct option — (1) Habitat loss and fragmentation
The 'Evil Quartet' names the four major causes of biodiversity loss: habitat loss and fragmentation, over-exploitation, alien species invasions, and co-extinctions.
Of these, habitat loss and fragmentation is considered the most important cause driving both animals and plants to extinction. When forests and other natural habitats are cleared or broken into small isolated patches, populations lose the space and resources they need to survive, and fragmentation cuts off movement and breeding.
So the leading cause is habitat loss and fragmentation.
From the chapter Biodiversity and Conservation — notes · practice set
Botany · Question 8
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
- Bright red colour
- Bright blue colour
- Bright yellow colour
- Bright orange colour
Correct option — (4) Bright orange colour
In gel electrophoresis, DNA fragments are separated but are colourless and invisible on their own. To see them, the gel is stained with ethidium bromide, a dye that slips (intercalates) between the DNA base pairs.
When the stained gel is then placed under UV light, the bound ethidium bromide fluoresces, and the DNA bands glow a bright orange colour, revealing where the fragments have migrated.
So the answer is bright orange.
From the chapter Biotechnology: Principles and Processes — notes · practice set
Botany · Question 9
Which micronutrient is required for splitting of water molecule during photosynthesis?
- Manganese
- Molybdenum
- Magnesium
- Copper
Correct option — (1) Manganese
The splitting of water (photolysis) during the light reactions releases oxygen and provides electrons and protons. This step, in the oxygen-evolving complex of Photosystem II, requires a specific metal.
• Manganese plays the major role in the water-splitting reaction that liberates oxygen — this is the answer.
Distinguish the other elements' roles:
• Copper is needed for overall metabolism (and in plastocyanin).
• Molybdenum is involved in nitrogen metabolism (nitrate reductase, nitrogenase).
• Magnesium — note this is the central atom of chlorophyll and activates enzymes, but it is not the water-splitting element; also, magnesium is a macronutrient, and the question specifically asks for a micronutrient.
So the answer is manganese.
From the chapter Mineral Nutrition — notes · practice set
Botany · Question 10
Axile placentation is observed in
- Mustard, Cucumber and Primrose
- China rose, Beans and Lupin
- Tomato, Dianthus and Pea
- China rose, Petunia and Lemon
Correct option — (4) China rose, Petunia and Lemon
In axile placentation the ovary is divided into chambers (locules) by septa, and the ovules are attached to a central axis where the septa meet. China rose, tomato, Petunia and lemon all show this arrangement.
Ruling out the other options by their true placentation types:
• Dianthus and Primrose → free central placentation.
• Pea, Lupin and Beans → marginal placentation.
• Cucumber and mustard → parietal placentation.
Since only option 4 (China rose, Petunia, Lemon) contains solely axile examples, that is the answer.
From the chapter Morphology of Flowering Plants — notes · practice set
Botany · Question 11
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
- Zygotene
- Pachytene
- Diplotene
- Diakinesis
Correct option — (2) Pachytene
Prophase I of meiosis has five sub-stages: leptotene, zygotene, pachytene, diplotene and diakinesis.
• During pachytene, the paired homologous chromosomes (bivalents) undergo crossing over — the exchange of segments between non-sister chromatids. This stage is marked by the appearance of recombination nodules, protein assemblies at the sites where crossing over takes place.
For reference: pairing (synapsis) begins in zygotene, but the recombination nodules and actual crossing over appear in pachytene.
So the answer is pachytene.
From the chapter Cell Cycle and Cell Division — notes · practice set
Botany · Question 12
The reaction centre in PS II has an absorption maxima at
- 680 nm
- 700 nm
- 660 nm
- 780 nm
Correct option — (1) 680 nm
The two photosystems are named after the wavelength their reaction-centre chlorophyll absorbs most strongly:
• Photosystem II (PS II) has its reaction centre at P680, absorbing maximally at 680 nm.
• Photosystem I (PS I) has its reaction centre at P700, absorbing at 700 nm.
An easy way to remember: despite being called PS "II", it actually acts first in the Z-scheme and absorbs the shorter wavelength (680 nm).
So the answer is 680 nm.
From the chapter Photosynthesis in Higher Plants — notes · practice set
Botany · Question 13
Unequivocal proof that DNA is the genetic material was first proposed by
- Frederick Griffith
- Alfred Hershey and Martha Chase
- Avery, Macleoid and McCarthy
- Wilkins and Franklin
Correct option — (2) Alfred Hershey and Martha Chase
Several scientists contributed to establishing DNA as the genetic material, but the unequivocal (unambiguous) proof came from the experiments of Alfred Hershey and Martha Chase (1952). Using bacteriophages with radioactively labelled DNA (32P) and protein (35S), they showed that only the DNA entered the bacterial cell and directed the production of new viruses.
The others' roles:
• Frederick Griffith discovered the 'transforming principle' using Pneumococcus.
• Avery, MacLeod and McCarty biochemically characterised that transforming principle as DNA.
• Wilkins and Franklin produced the X-ray diffraction data of DNA.
So the definitive proof was by Hershey and Chase.
From the chapter Molecular Basis of Inheritance — notes · practice set
Botany · Question 14
Among eukaryotes, replication of DNA takes place in:
- M phase
- S phase
- G1 phase
- G2 phase
Correct option — (2) S phase
The interphase of the cell cycle is divided into G1, S and G2.
• DNA replication happens specifically in the S phase (S for synthesis). During this phase the DNA content of the cell doubles, so each chromosome comes to consist of two sister chromatids.
The other phases do different jobs:
• G1 — the cell grows and most cell organelles duplicate.
• G2 — the cell prepares proteins for division.
• M phase — the actual division (mitosis) occurs.
So DNA replication takes place in the S phase.
From the chapter Cell Cycle and Cell Division — notes · practice set
Botany · Question 15
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as
- Differentiation
- Dedifferentiation
- Development
- Senescence
Correct option — (2) Dedifferentiation
Mature leaf mesophyll cells are already differentiated — they have lost the ability to divide. When placed in a culture medium and made to form an unorganised mass of dividing cells (callus), they must regain the capacity to divide.
This regaining of division capacity by already-differentiated living cells is called dedifferentiation.
Distinguish the terms:
• Differentiation — cells maturing into specialised forms.
• Redifferentiation — dedifferentiated cells maturing again into specialised cells.
• Dedifferentiation — mature cells reverting to a dividing state (what happens here).
So the answer is dedifferentiation.
From the chapter Cell: The Unit of Life — notes · practice set
Botany · Question 16
Cellulose does not form blue colour with Iodine because
- It is a disaccharide
- It is a helical molecule
- It does not contain complex helices and hence cannot hold iodine molecules
- It breaks down when iodine reacts with it
Correct option — (3) It does not contain complex helices and hence cannot hold iodine molecules
The blue colour of the iodine test comes from iodine molecules getting trapped inside the coiled, helical structure of a polysaccharide (as in starch's amylose component).
Cellulose is made of β-glucose units joined so that the chains are straight and unbranched, running parallel to form rigid fibres. It has no complex helical coils in which iodine could sit. With nowhere to trap the iodine, no blue colour forms.
Option 1 is wrong because cellulose is a polysaccharide, not a disaccharide.
So the answer is that it lacks complex helices to hold iodine molecules.
From the chapter Biomolecules — notes · practice set
Botany · Question 17
Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period, that leads early seed production?
- Indole-3-butyric Acid
- Gibberellic Acid
- Zeatin
- Abscisic Acid
Correct option — (2) Gibberellic Acid
Conifers take many years to mature from the juvenile stage to seed-bearing age. Growers can speed this up.
Spraying juvenile conifers with gibberellins (gibberellic acid, GA) hastens the maturity period, causing the trees to reach seed-producing maturity earlier.
The others don't do this:
• Indole-3-butyric acid is an auxin, used mainly for rooting.
• Zeatin is a cytokinin, promoting cell division.
• Abscisic acid is a growth inhibitor (the 'stress hormone').
So the answer is gibberellic acid.
From the chapter Plant Growth and Development — notes · practice set
Botany · Question 18
Given below are two statements:
Statement I: The forces generated transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II: Transpiration cools leaf surfaces sometimes 10 to 15 degrees evaporative cooling.
In the light of the above statements, choose the most appropriate answer.
- Both Statement I and Statement II are correct
- Both Statement I and Statement II are incorrect
- Statement I is correct but Statement II is incorrect
- Statement I is incorrect but Statement II is correct
Correct option — (1) Both Statement I and Statement II are correct
Statement I is correct. The transpiration pull generated at the leaves creates enough tension in the continuous water column of the xylem to raise water to great heights — measurements show it can support a xylem-sized column over 130 metres tall, which is why even the tallest trees can move water to their crowns.
Statement II is correct. As water evaporates from leaf surfaces during transpiration, it carries away heat (evaporative cooling), cooling the leaf by as much as 10 to 15 degrees. This protects the leaf from overheating in strong sunlight.
Both statements are correct.
From the chapter Transport in Plants — notes · practice set
Botany · Question 19
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
- Diadelphous and Dithecous anthers
- Polyadelphous and epipetalous stamens
- Monoadelphous and Monothecous anthers
- Epiphyllous and Dithecous anthers
Correct option — (1) Diadelphous and Dithecous anthers
Compare the stamen (androecium) features of the three families:
• Fabaceae: the stamens are diadelphous (fused into two bundles — usually 9 united + 1 free) with dithecous anthers.
• Solanaceae: polyandrous, epipetalous (attached to petals), dithecous.
• Liliaceae: polyandrous, epiphyllous (attached to tepals), dithecous.
The feature that is unique to Fabaceae and absent in the other two is the diadelphous condition. The dithecous nature is shared by all three, but the diadelphous grouping is Fabaceae's distinctive marker.
So the answer is diadelphous and dithecous anthers.
From the chapter Morphology of Flowering Plants — notes · practice set
Botany · Question 20
Expressed Sequence Tags (ESTs) refers to
- All genes that are expressed as RNA
- All genes that are expressed as proteins
- All genes whether expressed or unexpressed
- Certain important expressed genes
Correct option — (1) All genes that are expressed as RNA
The Human Genome Project used two main approaches. One of them, the 'Expressed Sequence Tags' approach, focused only on the parts of the genome that are actually transcribed.
ESTs refer to all the genes that are expressed as RNA — that is, the sequences that get transcribed into RNA, identifying the functional, coding portions of the genome while ignoring the non-expressed regions.
Note the precise wording: expressed as RNA, not specifically as proteins — this includes all transcribed sequences.
So the answer is all genes that are expressed as RNA.
From the chapter Biotechnology: Principles and Processes — notes · practice set
Botany · Question 21
Identify the correct statements:
(A) Detrivores perform fragmentation.
(B) The humus is further degraded by some microbes during mineralization.
(C) Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.
(D) The detritus food chain begins with living organisms.
(E) Earthworms break down detritus into smaller particles by a process called catabolism.
- A, B, C only
- B, C, D only
- C, D, E only
- D, E, A only
Correct option — (1) A, B, C only
Examine each statement about decomposition:
• (A) Correct. Detritivores (like earthworms) perform fragmentation, breaking detritus into smaller pieces.
• (B) Correct. During mineralisation, microbes degrade humus, releasing inorganic nutrients.
• (C) Correct. Leaching is when water-soluble inorganic nutrients percolate down and get precipitated in the soil.
The two wrong statements:
• (D) Wrong. The detritus food chain begins with dead organic matter (detritus), not living organisms.
• (E) Wrong. Earthworms breaking detritus into smaller particles is fragmentation, not catabolism. (Catabolism is the chemical breakdown into inorganic substances by microbes.)
So the correct statements are A, B, C only.
From the chapter Ecosystem — notes · practice set
Botany · Question 22
The thickness of ozone in a column of air in the atmosphere is measured in terms of:
- Dobson units
- Decibels
- Decameter
- Kilobase
Correct option — (1) Dobson units
Ozone thickness in a vertical column of the atmosphere, from the ground to the top, is measured in Dobson Units (DU).
The other units belong to entirely different quantities:
• Decibels measure sound intensity (noise).
• Decameter is a unit of length.
• Kilobase measures the length of a nucleic acid (number of bases).
So the answer is Dobson units.
From the chapter Environmental Issues — notes · practice set
Botany · Question 23
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Late wood has fewer xylary elements with narrow vessels.
Reason R: Cambium is less active in winters.
- Both A and R are true and R is the correct explanation of A
- Both A and R are true but R is NOT the correct explanation of A
- A is true but R is false
- A is false but R is true
Correct option — (1) Both A and R are true and R is the correct explanation of A
Trees form growth rings because the vascular cambium's activity changes with the seasons.
In winter (or autumn), conditions are less favourable and the cambium is less active. It therefore produces fewer xylem elements, and those it does make have narrower vessels. This tissue is called late wood (autumn wood) and appears darker and denser.
So the assertion (late wood has fewer, narrower xylem elements) is true, and the reason (cambium is less active in winter) is true and correctly explains why late wood has this structure.
So both are true and R is the correct explanation of A.
From the chapter Anatomy of Flowering Plants — notes · practice set
Botany · Question 24
Which of the following stages of meiosis involves division of centromere?
- Metaphase I
- Metaphase II
- Anaphase II
- Telophase
Correct option — (3) Anaphase II
The centromere splits — allowing sister chromatids to separate — only at a specific point.
• In anaphase II of meiosis, the centromeres divide and the sister chromatids finally separate, moving to opposite poles. (The same splitting happens in anaphase of mitosis.)
What happens in the other stages:
• Metaphase I and II — chromosomes align at the equator; centromeres do not split.
• In anaphase I, homologous chromosomes separate but their centromeres do not divide (sister chromatids stay together).
• Telophase — chromosomes have reached the poles.
So the centromere divides in anaphase II.
From the chapter Cell Cycle and Cell Division — notes · practice set
Botany · Question 25
The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year
- 1985
- 1992
- 1986
- 2002
Correct option — (2) 1992
The historic Convention on Biological Diversity, known as 'The Earth Summit', was held in Rio de Janeiro in 1992.
It called upon all nations to take appropriate measures for the conservation of biodiversity and the sustainable, fair use of its benefits.
(A follow-up, the World Summit on Sustainable Development, was held in Johannesburg in 2002 — that is why 2002 appears as a distractor.)
So the answer is 1992.
From the chapter Biodiversity and Conservation — notes · practice set
Botany · Question 26
How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle?
- 12 ATP and 12 NADPH2
- 18 ATP and 12 NADPH2
- 12 ATP and 16 NADPH2
- 18 ATP and 16 NADPH2
Correct option — (2) 18 ATP and 12 NADPH2
Work out the requirement per turn, then multiply.
For every CO2 molecule fixed in the Calvin cycle, the cell uses:
• 3 ATP and 2 NADPH2
To build one molecule of glucose (a 6-carbon sugar), 6 molecules of CO2 must be fixed, so the cycle turns 6 times:
$$\text{ATP} = 6 \times 3 = 18$$
$$\text{NADPH}_2 = 6 \times 2 = 12$$
So one glucose requires 18 ATP and 12 NADPH2.
From the chapter Photosynthesis in Higher Plants — notes · practice set
Botany · Question 27
In the equation GPP − R = NPP, where GPP is Gross Primary Productivity and NPP is Net Primary Productivity, R here is ________.
- Photosynthetically active radiation
- Respiratory quotient
- Respiratory loss
- Reproductive allocation
Correct option — (3) Respiratory loss
Gross Primary Productivity (GPP) is the total amount of organic matter a plant produces through photosynthesis. But the plant uses a portion of this for its own respiration.
Whatever remains after respiration is the Net Primary Productivity (NPP) — the biomass actually available for growth and for the next trophic level:
$$\text{NPP} = \text{GPP} - R$$
Here R stands for the respiratory loss — the energy the plant consumes in its own respiration.
So R is respiratory loss.
From the chapter Ecosystem — notes · practice set
Botany · Question 28
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
- RNA
- DNA
- Histones
- Polysaccharides
Correct option — (2) DNA
In isolating the genetic material, the cell is broken open and various molecules are removed step by step: RNA with ribonuclease, proteins with proteases, and so on.
The final step to obtain the purified genetic material is the addition of chilled ethanol, which causes the DNA to precipitate out as fine, collectible threads.
Ruling out the others: RNA is removed earlier by ribonuclease treatment, and proteins (including histones) are removed by proteases — so what chilled ethanol precipitates is the DNA.
So the answer is DNA.
From the chapter Biotechnology: Principles and Processes — notes · practice set
Botany · Question 29
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
- Transcription of rRNAs (28S, 18S and 5.8S)
- Transcription of tRNA, 5S rRNA and snRNA
- Transcription of precursor of mRNA
- Transcription of only snRNAs
Correct option — (2) Transcription of tRNA, 5S rRNA and snRNA
Eukaryotes have three RNA polymerases, each transcribing a distinct set of RNAs:
• RNA polymerase I → the large ribosomal RNAs: 28S, 18S, 5.8S rRNA.
• RNA polymerase II → hnRNA (the precursor of mRNA).
• RNA polymerase III → the small stable RNAs: tRNA, 5S rRNA and snRNA.
So RNA polymerase III transcribes tRNA, 5S rRNA and snRNA — option 2. (Note option 1 lists the job of Pol I, and option 3 the job of Pol II.)
From the chapter Molecular Basis of Inheritance — notes · practice set
Botany · Question 30
What is the function of tassels in the corn cob?
- To attract insects
- To trap pollen grains
- To disperse pollen grains
- To protect seeds
Correct option — (2) To trap pollen grains
The silky threads (tassels) hanging from a corn cob are actually the long styles and stigmas of the female flowers.
Maize is wind-pollinated, so these long, feathery structures wave in the wind, greatly increasing the surface area to trap pollen grains carried on air currents. Each captured pollen grain can then fertilise an ovule, developing into a kernel.
So the function of the tassels is to trap pollen grains.
From the chapter Sexual Reproduction in Flowering Plants — notes · practice set
Botany · Question 31
Identify the pair of heterosporous pteridophytes among the following:
- Lycopodium and Selaginella
- Selaginella and Salvinia
- Psilotum and Salvinia
- Equisetum and Salvinia
Correct option — (2) Selaginella and Salvinia
Heterosporous plants produce two different kinds of spores — small microspores and large megaspores. Most pteridophytes are homosporous (one kind of spore), but a few are heterosporous.
Among these genera, the two heterosporous ones are Selaginella and Salvinia.
The rest — Psilotum, Lycopodium and Equisetum — are all homosporous.
So the heterosporous pair is Selaginella and Salvinia. (Heterospory is biologically important — it is considered a precursor to the seed habit.)
From the chapter Plant Kingdom — notes · practice set
Botany · Question 32
In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.
- Copper
- Zinc
- Tungsten or gold
- Silver
Correct option — (3) Tungsten or gold
The gene gun (biolistics) method physically shoots DNA-coated metal particles into plant cells. The metal used must be chemically inert, so it does not react with or damage the cell's contents.
Tungsten or gold microparticles are used. Being inert and dense, they carry the DNA into the cell without altering the cell's chemistry.
So the answer is tungsten or gold.
From the chapter Biotechnology: Principles and Processes — notes · practice set
Botany · Question 33
Given below are two statements:
Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II: Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer.
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is correct but Statement II is false
- Statement I is incorrect but Statement II is true
Correct option — (4) Statement I is incorrect but Statement II is true
Statement I is false. Endarch and exarch describe the position of the primary xylem (specifically, the relative positions of protoxylem and metaxylem), not the secondary xylem.
Statement II is true. In the exarch arrangement the protoxylem lies towards the periphery and metaxylem towards the centre — and this is indeed the characteristic condition of roots. (In stems it is the opposite: endarch, with protoxylem towards the centre.)
So Statement I is incorrect but Statement II is true.
From the chapter Anatomy of Flowering Plants — notes · practice set
Botany · Question 34
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
- Thomas Hunt Morgan
- Sutton and Boveri
- Alfred Sturtevant
- Henking
Correct option — (3) Alfred Sturtevant
The idea of using recombination frequency as a ruler for gene distances led to the first genetic maps.
Alfred Sturtevant (a student of Morgan) was the first to use the frequency of recombination between gene pairs on the same chromosome as a measure of the distance between them, and thereby 'mapped' their positions on the chromosome.
The others did different things:
• Thomas Hunt Morgan proved the chromosomal theory of inheritance and worked out linkage.
• Sutton and Boveri proposed the chromosomal theory of inheritance.
• Henking discovered the X-chromosome.
So the answer is Alfred Sturtevant.
From the chapter Principles of Inheritance and Variation — notes · practice set
Botany · Question 35
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: ATP is used at two steps in glycolysis.
Reason R: First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1,6-diphosphate.
- Both A and R are true and R is the correct explanation of A
- Both A and R are true but R is NOT the correct explanation of A
- A is true but R is false
- A is false but R is true
Correct option — (1) Both A and R are true and R is the correct explanation of A
Assertion is true. Glycolysis has an initial 'investment' phase in which two ATP molecules are consumed before any are produced.
Reason is true and explains it. The two ATP-consuming steps are exactly:
1. Glucose → glucose-6-phosphate (catalysed by hexokinase)
2. Fructose-6-phosphate → fructose-1,6-bisphosphate (catalysed by phosphofructokinase)
In both, ATP donates a phosphate group to phosphorylate the sugar. So the reason correctly identifies the two steps where ATP is used and thereby explains the assertion.
So both are true and R is the correct explanation of A.
From the chapter Respiration in Plants — notes · practice set
Botany · Question 36
Which one of the following statements is NOT correct?
- The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms
- Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries
- Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body
- The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels
Correct option — (2) Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries
The question asks for the incorrect statement.
• Option 2 is NOT correct. Algal blooms do the opposite of improving water quality — they impart an unpleasant colour, deteriorate the water, deplete its oxygen when they decay, and cause fish mortality. They harm, not help, fisheries.
The other three are all correct: decomposer microbes consume oxygen (causing fish deaths), water hyacinth (the 'terror of Bengal') disrupts eutrophic water bodies, and toxic substances undergo biomagnification up the trophic levels.
So the incorrect statement is option 2.
From the chapter Environmental Issues — notes · practice set
Botany · Question 37
How many different proteins does the ribosome consist of?
- 80
- 60
- 40
- 20
Correct option — (1) 80
A ribosome is a large ribonucleoprotein — a complex of ribosomal RNA and many proteins working together as the cell's protein-synthesis machine.
It is composed of structural rRNAs and about 80 different proteins.
So the answer is 80.
From the chapter Molecular Basis of Inheritance — notes · practice set
Botany · Question 38
Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer.
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is correct but Statement II is false
- Statement I is incorrect but Statement II is true
Correct option — (4) Statement I is incorrect but Statement II is true
The key fact: DNA is negatively charged (because of its phosphate backbone), and it is packaged by positively charged proteins that neutralise and organise it.
Statement I is false. It states the DNA is positively charged and the proteins negatively charged — both are backwards. In prokaryotes the negatively charged DNA is held with positively charged proteins in the nucleoid.
Statement II is true. In eukaryotes the negatively charged DNA wraps around the positively charged histone octamer to form the nucleosome — this is correctly stated.
So Statement I is incorrect but Statement II is true.
From the chapter Molecular Basis of Inheritance — notes · practice set
Zoology
Zoology
49 questions with worked solutions · diagram-based questions omitted
Zoology · Question 1
Match List I with List II.
List I: (A) Vasectomy (B) Coitus interruptus (C) Cervical caps (D) Saheli
List II: (I) Oral method (II) Barrier method (III) Surgical method (IV) Natural method
- A-III, B-I, C-IV, D-II
- A-III, B-IV, C-II, D-I
- A-II, B-III, C-I, D-IV
- A-IV, B-II, C-I, D-III
Correct option — (2) A-III, B-IV, C-II, D-I
Classify each contraceptive method:
• Vasectomy — cutting/tying the vas deferens is a surgical (sterilisation) method (III).
• Coitus interruptus — withdrawal before ejaculation is a natural method (IV).
• Cervical caps — a physical device that blocks sperm entry is a barrier method (II).
• Saheli — a non-steroidal 'once a week' pill is an oral method (I).
So A-III, B-IV, C-II, D-I.
From the chapter Reproductive Health — notes · practice set
Zoology · Question 2
Given below are two statements:
Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal.
In the light of the above statements, choose the correct answer.
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is correct but Statement II is false
- Statement I is incorrect but Statement II is true
Correct option — (1) Both Statement I and Statement II are true
Statement I is true. In the male tract, the vas deferens is joined by the duct of the seminal vesicle, and together they continue as the ejaculatory duct, which opens into the urethra.
Statement II is true. In the female tract, the cavity of the cervix is the cervical canal. This canal, together with the vagina, forms the birth canal through which the baby passes during delivery.
Both statements are accurate descriptions of reproductive anatomy, so both are true.
From the chapter Human Reproduction — notes · practice set
Zoology · Question 3
Which of the following statements is correct?
- Eutrophication refers to increase in domestic sewage and waste water in lakes.
- Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
- Presence of large amount of nutrients in water restricts 'Algal Bloom'.
- Algal Bloom decreases fish mortality
Correct option — (2) Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
Check each definition:
• Option 2 is correct. Biomagnification is exactly this — the concentration of a toxicant (like DDT or mercury) increases at each successive trophic level as it passes up the food chain.
Why the others are wrong:
• Option 1: Eutrophication refers to the natural ageing of a lake by nutrient enrichment, not simply an increase in sewage.
• Option 3: A large amount of nutrients promotes (not restricts) algal bloom.
• Option 4: Algal bloom increases fish mortality, not decreases it.
So the correct statement is option 2.
From the chapter Ecosystem — notes · practice set
Zoology · Question 4
Which one of the following symbols represents mating between relatives in human pedigree analysis?
- A single line joining a square and circle
- A double line joining a square and circle
- A vertical line to a filled square (offspring)
- Three filled shapes in a row
Correct option — (2) A double line joining a square and circle
In pedigree charts, a mating between two individuals is shown by a horizontal line joining them. But when the two individuals are related (a consanguineous mating), a double horizontal line is used to join the square (male) and circle (female).
A single line indicates a normal (non-consanguineous) mating, while the double line specifically flags that the partners share ancestry — important because consanguineous matings raise the chance of recessive disorders in the offspring.
So the answer is the double line joining a square and a circle.
From the chapter Principles of Inheritance and Variation — notes · practice set
Zoology · Question 5
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
- Genital herpes
- Gonorrhoea
- Hepatitis-B
- HIV Infection
Correct option — (2) Gonorrhoea
The key distinction is bacterial versus viral. Bacterial STDs can generally be cured with antibiotics; viral ones cannot be fully cured.
• Gonorrhoea is caused by a bacterium (Neisseria gonorrhoeae). Detected early and treated properly with antibiotics, it is completely curable.
The others are all viral and not completely curable:
• Genital herpes — herpes simplex virus.
• Hepatitis-B — hepatitis B virus.
• HIV infection — human immunodeficiency virus.
So the curable one is gonorrhoea.
From the chapter Human Health and Disease — notes · practice set
Zoology · Question 6
Match List I with List II.
List I: (A) Heroin (B) Marijuana (C) Cocaine (D) Morphine
List II: (I) Effect on cardiovascular system (II) Slow down body function (III) Painkiller (IV) Interfere with transport of dopamine
- A-II, B-I, C-IV, D-III
- A-I, B-II, C-III, D-IV
- A-IV, B-III, C-II, D-I
- A-III, B-IV, C-I, D-II
Correct option — (1) A-II, B-I, C-IV, D-III
Match each drug to its characteristic effect:
• Heroin — an opioid and a depressant that slows down body functions (II).
• Marijuana — cannabinoids that particularly affect the cardiovascular system (I).
• Cocaine — interferes with the transport of the neurotransmitter dopamine, producing its stimulant 'high' (IV).
• Morphine — a sedative used as a painkiller (III).
So A-II, B-I, C-IV, D-III.
From the chapter Human Health and Disease — notes · practice set
Zoology · Question 7
Match List I with List II.
List I (Type of Joint): (A) Cartilaginous Joint (B) Ball and Socket Joint (C) Fibrous Joint (D) Saddle Joint
List II (Found between): (I) Between flat skull bones (II) Between adjacent vertebrae in vertebral column (III) Between carpal and metacarpal of thumb (IV) Between Humerus and Pectoral girdle
- A-III, B-I, C-II, D-IV
- A-II, B-IV, C-I, D-III
- A-I, B-IV, C-III, D-II
- A-II, B-IV, C-III, D-I
Correct option — (2) A-II, B-IV, C-I, D-III
Match each joint type to where it is found:
• Cartilaginous joint — bones joined by cartilage, as between adjacent vertebrae (II).
• Ball and socket joint — allows movement in all planes, as between the humerus and pectoral girdle (shoulder) (IV).
• Fibrous joint — immovable, held by fibrous tissue, as between the flat skull bones (sutures) (I).
• Saddle joint — as between the carpal and metacarpal of the thumb, giving the thumb its wide movement (III).
So A-II, B-IV, C-I, D-III.
From the chapter Locomotion and Movement — notes · practice set
Zoology · Question 8
Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal).
Statement II: Adult human haemoglobin consists of 4 subunits (two subunits of α type and two subunits of β type).
In the light of the above statements, choose the correct answer.
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is true but Statement II is false
- Statement I is false but Statement II is true
Correct option — (4) Statement I is false but Statement II is true
Statement I is false — the terminals are swapped. By convention a protein is drawn as a line with the first amino acid at the left being the N-terminal and the last amino acid at the right being the C-terminal. Statement I reverses these labels.
Statement II is true. Adult human haemoglobin (HbA) is a tetramer of four subunits — two α chains and two β chains (α2β2).
So Statement I is false but Statement II is true.
From the chapter Biomolecules — notes · practice set
Zoology · Question 9
Which of the following are NOT considered as the part of endomembrane system?
(A) Mitochondria (B) Endoplasmic reticulum (C) Chloroplasts (D) Golgi complex (E) Peroxisomes
- B and D only
- A, C and E only
- A and D only
- A, D and E only
Correct option — (2) A, C and E only
The endomembrane system is the group of organelles whose functions are coordinated together: the endoplasmic reticulum, Golgi complex, lysosomes and vacuoles.
The question asks which are NOT part of it. Three organelles are excluded because their functions are not coordinated with that system:
• (A) Mitochondria — has its own membrane system and functions independently.
• (C) Chloroplasts — likewise independent (and semi-autonomous).
• (E) Peroxisomes — not considered part of the endomembrane system.
The two that are part of it are the endoplasmic reticulum (B) and Golgi complex (D).
So the ones NOT included are A, C and E.
From the chapter Cell: The Unit of Life — notes · practice set
Zoology · Question 10
Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer.
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is true but Statement II is false
- Statement I is false but Statement II is true
Correct option — (1) Both Statement I and Statement II are true
Statement I is true. RNA is chemically less stable than DNA (the extra hydroxyl group makes it more reactive), and RNA replication lacks efficient proofreading. As a result RNA mutates at a faster rate.
Statement II is true and follows from I. Because their genetic material mutates quickly, viruses with an RNA genome — combined with a short life span and rapid reproduction — mutate and evolve much faster. (This is why RNA viruses like influenza and HIV are so hard to vaccinate against.)
Both statements are true, and the second is a consequence of the first.
From the chapter Evolution — notes · practice set
Zoology · Question 11
Match List I with List II.
List I: (A) CCK (B) GIP (C) ANF (D) ADH
List II: (I) Kidney (II) Heart (III) Gastric gland (IV) Pancreas
- A-IV, B-III, C-II, D-I
- A-III, B-II, C-IV, D-I
- A-II, B-IV, C-I, D-III
- A-IV, B-II, C-III, D-I
Correct option — (1) A-IV, B-III, C-II, D-I
Match each hormone to its target or source organ:
• CCK (Cholecystokinin) acts on the gall bladder and pancreas, stimulating secretion of bile and pancreatic enzymes (IV).
• GIP (Gastric Inhibitory Peptide) inhibits gastric gland secretion and motility (III).
• ANF (Atrial Natriuretic Factor) is released from the atrial wall of the heart (II).
• ADH (Anti-diuretic hormone) acts mainly on the kidney, promoting water reabsorption (I).
So A-IV, B-III, C-II, D-I.
From the chapter Chemical Coordination and Integration — notes · practice set
Zoology · Question 12
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Endometrium is necessary for implantation of blastocyst.
Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
- Both A and R are true and R is the correct explanation of A
- Both A and R are true but R is NOT the correct explanation of A
- A is true but R is false
- A is false but R is true
Correct option — (2) Both A and R are true but R is NOT the correct explanation of A
Assertion is true. Implantation is the embedding of the blastocyst into the endometrium (uterine lining), so a well-developed endometrium is indeed necessary for it.
Reason is true. The corpus luteum secretes progesterone, which maintains the endometrium. If fertilisation does not occur, the corpus luteum degenerates; progesterone falls, and the endometrium disintegrates (menstruation).
But R does not explain A. The assertion is about why the endometrium is needed for implantation. The reason describes what happens when there is no fertilisation — the breakdown of the endometrium. These are two separate facts; the reason doesn't explain why the endometrium is required for implantation.
So both are true, but R is not the correct explanation of A.
From the chapter Human Reproduction — notes · practice set
Zoology · Question 13
Match List I with List II.
List I: (A) Ringworm (B) Filariasis (C) Malaria (D) Pneumonia
List II: (I) Haemophilus influenzae (II) Trichophyton (III) Wuchereria bancrofti (IV) Plasmodium vivax
- A-II, B-III, C-IV, D-I
- A-II, B-III, C-I, D-IV
- A-III, B-II, C-I, D-IV
- A-III, B-II, C-IV, D-I
Correct option — (1) A-II, B-III, C-IV, D-I
Match each disease to its causative organism:
• Ringworm — a fungal infection caused by Trichophyton (and related genera) (II).
• Filariasis (elephantiasis) — caused by the filarial worm Wuchereria bancrofti (III).
• Malaria — caused by the protozoan Plasmodium (here P. vivax) (IV).
• Pneumonia — caused by the bacterium Haemophilus influenzae (also Streptococcus pneumoniae) (I).
So A-II, B-III, C-IV, D-I.
From the chapter Human Health and Disease — notes · practice set
Zoology · Question 14
Given below are two statements:
Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer.
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is true but Statement II is false
- Statement I is false but Statement II is true
Correct option — (1) Both Statement I and Statement II are true
Statement I is true. Enzymes are proteins with an optimum temperature. At low temperatures they become temporarily inactive but are preserved — warming restores activity. At high temperatures the protein structure is denatured (unfolded), permanently destroying activity.
Statement II is true. A competitive inhibitor is defined exactly this way — it structurally resembles the substrate and competes with it for the active site, thereby inhibiting the enzyme.
Both statements are correct definitions, so both are true.
From the chapter Biomolecules — notes · practice set
Zoology · Question 15
Match List I with List II.
List I: (A) Taenia (B) Paramoecium (C) Periplaneta (D) Pheretima
List II: (I) Nephridia (II) Contractile vacuole (III) Flame cells (IV) Urecose gland
- A-I, B-II, C-III, D-IV
- A-I, B-II, C-IV, D-III
- A-III, B-II, C-IV, D-I
- A-II, B-I, C-IV, D-III
Correct option — (3) A-III, B-II, C-IV, D-I
Match each animal to its excretory structure:
• Taenia (tapeworm, a flatworm) — uses flame cells (protonephridia) (III).
• Paramoecium (a protozoan) — uses a contractile vacuole to expel water and wastes (II).
• Periplaneta (cockroach) — has Malpighian tubules and urecose glands (IV).
• Pheretima (earthworm, an annelid) — uses nephridia (I).
So A-III, B-II, C-IV, D-I.
From the chapter Structural Organisation in Animals — notes · practice set
Zoology · Question 16
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
- Recombinant DNA Technology
- Serum and Urine analysis
- Polymerase Chain Reaction (PCR) technique
- Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
Correct option — (2) Serum and Urine analysis
The question asks which technique does not help in early diagnosis.
• Serum and urine analysis is a conventional method. It usually detects a disease only after symptoms have appeared and levels have changed — it does not catch the disease early, when very few pathogen molecules are present.
The other three are modern molecular/immunological techniques that can detect a pathogen at very low levels, enabling early diagnosis:
• Recombinant DNA technology.
• PCR — amplifies tiny amounts of pathogen nucleic acid, detecting very low infection.
• ELISA — detects antigens or antibodies sensitively.
So the technique that does not serve early diagnosis is serum and urine analysis.
From the chapter Biotechnology and its Applications — notes · practice set
Zoology · Question 17
Match List I with List II.
List I (Interacting species): (A) A Leopard and a Lion in a forest/grassland (B) A Cuckoo laying egg in a Crow's nest (C) Fungi and root of a higher plant in Mycorrhizae (D) A cattle egret and a Cattle in a field
List II (Name of interaction): (I) Competition (II) Brood parasitism (III) Mutualism (IV) Commensalism
- A-I, B-II, C-III, D-IV
- A-I, B-II, C-IV, D-III
- A-III, B-IV, C-I, D-II
- A-II, B-III, C-I, D-IV
Correct option — (1) A-I, B-II, C-III, D-IV
Identify each population interaction:
• Leopard and lion both hunt the same prey — they are in competition (I).
• Cuckoo laying eggs in a crow's nest — the cuckoo tricks the crow into raising its young; this is brood parasitism (II).
• Fungi and plant roots in mycorrhizae — both benefit (the fungus gets sugars, the plant gets better mineral uptake); this is mutualism (III).
• Cattle egret and cattle — the egret benefits (catching insects stirred up by grazing cattle) while the cattle are unaffected; this is commensalism (IV).
So A-I, B-II, C-III, D-IV.
From the chapter Organisms and Populations — notes · practice set
Zoology · Question 18
Given below are two statements:
Statement I: Ligaments are dense irregular tissue.
Statement II: Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer.
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is true but Statement II is false
- Statement I is false but Statement II is true
Correct option — (2) Both Statement I and Statement II are false
Both statements misclassify the tissues.
Statement I is false. Ligaments are dense regular connective tissue (collagen fibres arranged in parallel bundles), not dense irregular. (Dense irregular tissue is found in the dermis of skin.)
Statement II is false. Cartilage is a specialised connective tissue, not dense regular connective tissue at all.
Since both classifications are wrong, both statements are false.
From the chapter Structural Organisation in Animals — notes · practice set
Zoology · Question 19
Match List I with List II with respect to human eye.
List I: (A) Fovea (B) Iris (C) Blind spot (D) Sclera
List II: (I) Visible coloured portion of eye that regulates diameter of pupil (II) External layer of eye formed of dense connective tissue (III) Point of greatest visual acuity or resolution (IV) Point where optic nerve leaves the eyeball and photoreceptor cells are absent
- A-III, B-I, C-IV, D-II
- A-IV, B-III, C-II, D-I
- A-I, B-IV, C-III, D-II
- A-II, B-I, C-III, D-IV
Correct option — (1) A-III, B-I, C-IV, D-II
Match each part of the eye to its description:
• Fovea — a pit packed with cones; the point of greatest visual acuity/resolution (III).
• Iris — the visible coloured portion that regulates the pupil's diameter (I).
• Blind spot — the point where the optic nerve leaves the eyeball, having no photoreceptor cells (IV).
• Sclera — the tough outer layer of dense connective tissue (the 'white' of the eye) (II).
So A-III, B-I, C-IV, D-II.
From the chapter Neural Control and Coordination — notes · practice set
Zoology · Question 20
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
- Tasmanian wolf, Bobcat, Marsupial mole
- Numbat, Spotted cuscus, Flying phalanger
- Mole, Flying squirrel, Tasmanian tiger cat
- Lemur, Anteater, Wolf
Correct option — (2) Numbat, Spotted cuscus, Flying phalanger
Australian marsupials are a classic example of adaptive radiation — from a common ancestor they diversified into many forms, each resembling a placental mammal elsewhere.
The set that contains only Australian marsupials is Numbat, Spotted cuscus, Flying phalanger (option 2).
The others each contain a placental mammal, disqualifying them:
• Option 1 — bobcat is a placental mammal.
• Option 3 — mole and flying squirrel are placental mammals.
• Option 4 — lemur and wolf are placental mammals.
So the correct set is Numbat, Spotted cuscus, Flying phalanger.
From the chapter Evolution — notes · practice set
Zoology · Question 21
Which of the following statements are correct regarding female reproductive cycle?
(A) In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
(B) First menstrual cycle begins at puberty and is called menopause.
(C) Lack of menstruation may be indicative of pregnancy.
(D) Cyclic menstruation extends between menarche and menopause.
- A and D only
- A and B only
- A, B and C only
- A, C and D only
Correct option — (4) A, C and D only
Check each statement:
• (A) Correct. In non-primate mammals the reproductive cycle is called the oestrus cycle (in primates it is the menstrual cycle).
• (C) Correct. A missed period (absence of menstruation) can indeed indicate pregnancy.
• (D) Correct. Cyclic menstruation extends between menarche (first period) and menopause (last period).
The wrong statement:
• (B) Wrong. The first menstrual cycle at puberty is called menarche, not menopause. Menopause is the cessation of cycles in later life.
So the correct statements are A, C and D.
From the chapter Human Reproduction — notes · practice set
Zoology · Question 22
Vital capacity of lung is ________.
- IRV + ERV
- IRV + ERV + TV + RV
- IRV + ERV + TV − RV
- IRV + ERV + TV
Correct option — (4) IRV + ERV + TV
Vital capacity (VC) is the maximum volume of air a person can breathe out after a maximum inspiration — or breathe in after a maximum expiration.
It is the sum of three volumes:
$$\text{VC} = \text{IRV} + \text{ERV} + \text{TV}$$
where IRV is inspiratory reserve volume, ERV is expiratory reserve volume, and TV is tidal volume.
Crucially, it does not include the residual volume (RV) — the air that always remains in the lungs and can never be exhaled. That is why option 2 (which adds RV) is wrong; adding RV would give the total lung capacity instead.
So VC = IRV + ERV + TV.
From the chapter Breathing and Exchange of Gases — notes · practice set
Zoology · Question 23
Match List I with List II.
List I: (A) P-wave (B) Q-wave (C) QRS complex (D) T-wave
List II: (I) Beginning of systole (II) Repolarisation of ventricles (III) Depolarisation of atria (IV) Depolarisation of ventricles
- A-III, B-I, C-IV, D-II
- A-IV, B-III, C-II, D-I
- A-II, B-IV, C-I, D-III
- A-I, B-II, C-III, D-IV
Correct option — (1) A-III, B-I, C-IV, D-II
Match each part of the ECG to the electrical event it represents:
• P-wave — the depolarisation of the atria, leading to atrial contraction (III).
• Q-wave — marks the beginning of systole (ventricular contraction) (I).
• QRS complex — the depolarisation of the ventricles, initiating ventricular contraction (IV).
• T-wave — the repolarisation of the ventricles, their return to the resting state (II).
So A-III, B-I, C-IV, D-II.
From the chapter Body Fluids and Circulation — notes · practice set
Zoology · Question 24
Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R.
Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason R: Ban on amniocentesis checks increasing menace of female foeticide.
- Both A and R are true and R is the correct explanation of A
- Both A and R are true and R is NOT the correct explanation of A
- A is true but R is false
- A is false but R is true
Correct option — (4) A is false but R is true
Assertion is false. The Reproductive and Child Health Care (RCH) programme aims to create awareness and provide facilities for a reproductively healthy society. Amniocentesis for sex determination is emphatically not one of its strategies — in fact, using amniocentesis to determine sex is illegal in India. (Amniocentesis is legitimately used to detect genetic disorders like Down's syndrome, not to determine sex.)
Reason is true. Banning amniocentesis for sex determination does help check the menace of female foeticide.
So A is false but R is true.
From the chapter Reproductive Health — notes · practice set
Zoology · Question 25
Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by
- Sphincter of Oddi
- Ileo-caecal valve
- Gastro-oesophageal sphincter
- Pyloric sphincter
Correct option — (2) Ileo-caecal valve
Trace where the caecum sits: it is the start of the large intestine, receiving material from the small intestine (ileum).
The ileo-caecal valve guards the junction between the ileum and the caecum. It lets material pass into the caecum but prevents backflow of the faecal matter into the small intestine.
The other sphincters guard different junctions:
• Sphincter of Oddi — the hepato-pancreatic duct opening.
• Gastro-oesophageal sphincter — oesophagus into stomach.
• Pyloric sphincter — stomach into duodenum.
So the answer is the ileo-caecal valve.
From the chapter Digestion and Absorption — notes · practice set
Zoology · Question 26
Match List I with List II.
List I: (A) Gene 'a' (B) Gene 'y' (C) Gene 'i' (D) Gene 'z'
List II: (I) β-galactosidase (II) Transacetylase (III) Permease (IV) Repressor protein
- A-II, B-I, C-IV, D-III
- A-II, B-III, C-IV, D-I
- A-III, B-IV, C-I, D-II
- A-III, B-I, C-IV, D-II
Correct option — (2) A-II, B-III, C-IV, D-I
Recall the genes of the lac operon and what each codes for:
• Gene z → β-galactosidase (breaks lactose into glucose and galactose) (I).
• Gene y → permease (increases lactose uptake into the cell) (III).
• Gene a → transacetylase (II).
• Gene i → the repressor protein (which blocks the operon when lactose is absent) (IV).
So A-II, B-III, C-IV, D-I. A handy way to remember z, y, a: the three structural genes in order code for β-galactosidase, permease and transacetylase.
From the chapter Molecular Basis of Inheritance — notes · practice set
Zoology · Question 27
Match List I with List II.
List I (Cells): (A) Peptic cells (B) Goblet cells (C) Oxyntic cells (D) Hepatic cells
List II (Secretion): (I) Mucus (II) Bile juice (III) Proenzyme pepsinogen (IV) HCl and intrinsic factor for absorption of vitamin B12
- A-IV, B-III, C-II, D-I
- A-II, B-I, C-III, D-IV
- A-III, B-I, C-IV, D-II
- A-II, B-IV, C-I, D-III
Correct option — (3) A-III, B-I, C-IV, D-II
Match each cell type to what it secretes:
• Peptic (chief) cells — secrete the proenzyme pepsinogen (III).
• Goblet cells — secrete mucus (I).
• Oxyntic (parietal) cells — secrete HCl and intrinsic factor (needed for vitamin B12 absorption) (IV).
• Hepatic cells (liver) — secrete bile juice (II).
So A-III, B-I, C-IV, D-II.
From the chapter Digestion and Absorption — notes · practice set
Zoology · Question 28
Which of the following functions is carried out by cytoskeleton in a cell?
- Nuclear division
- Protein synthesis
- Motility
- Transportation
Correct option — (3) Motility
The cytoskeleton is a network of filamentous proteins — microtubules, microfilaments and intermediate filaments — running through the cytoplasm.
Its functions include mechanical support, maintaining the cell's shape, and motility (movement). Of the options given, motility is the function carried out by the cytoskeleton.
The others belong to different structures: nuclear division is chromosome/spindle-related, protein synthesis is done by ribosomes, and bulk transportation is largely a role of the endomembrane system.
So the answer is motility.
From the chapter Cell: The Unit of Life — notes · practice set
Zoology · Question 29
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.
Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.
- Both A and R are true and R is the correct explanation of A
- Both A and R are true but R is NOT the correct explanation of A
- A is true but R is false
- A is false but R is true
Correct option — (3) A is true but R is false
Assertion is true. Nephrons are indeed of two types based on their position — cortical and juxtamedullary.
Reason is false — it reverses the loop lengths. In fact:
• Juxtamedullary nephrons have a long loop of Henle that runs deep into the medulla (they are key to concentrating urine).
• Cortical nephrons have a short loop that barely dips into the medulla.
The reason states the opposite, so it is false.
So A is true but R is false.
From the chapter Excretory Products and Elimination — notes · practice set
Zoology · Question 30
Given below are two statements:
Statement I: Electrostatic precipitator is most widely used in thermal power plant.
Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations.
In the light of the above statements, choose the most appropriate answer.
- Both Statement I and Statement II are correct
- Both Statement I and Statement II are incorrect
- Statement I is correct but Statement II is incorrect
- Statement I is incorrect but Statement II is correct
Correct option — (3) Statement I is correct but Statement II is incorrect
Statement I is correct. The electrostatic precipitator is the most widely used device to control air pollution from thermal power plants. It can remove over 99% of the particulate matter in the exhaust.
Statement II is incorrect. The precipitator removes particulate matter (fine dust and ash), not ionising radiations. It works by charging the dust particles and collecting them on oppositely charged plates — it has nothing to do with radiation.
So Statement I is correct but Statement II is incorrect.
From the chapter Environmental Issues — notes · practice set
Zoology · Question 31
Broad palm with single palm crease is visible in a person suffering from-
- Down's syndrome
- Turner's syndrome
- Klinefelter's syndrome
- Thalassemia
Correct option — (1) Down's syndrome
A broad palm with a single transverse (simian) palm crease is a classic physical feature of Down's syndrome.
Down's syndrome is caused by an extra copy of chromosome 21 (trisomy 21). Its other features include a short stature with a small round head, a furrowed protruding tongue, partially open mouth, and characteristic facial features.
So the answer is Down's syndrome.
From the chapter Principles of Inheritance and Variation — notes · practice set
Zoology · Question 32
Radial symmetry is NOT found in adults of phylum ______.
- Ctenophora
- Hemichordata
- Coelenterata
- Echinodermata
Correct option — (2) Hemichordata
The question asks which phylum's adults are not radially symmetrical.
• Hemichordata — these animals are bilaterally symmetrical, so radial symmetry is NOT found in them. This is the answer.
The other three all show radial symmetry in adults:
• Ctenophora — radially symmetrical.
• Coelenterata (Cnidaria) — radially symmetrical.
• Echinodermata — larvae are bilateral, but the adults show radial (pentamerous) symmetry.
So radial symmetry is absent in the adults of Hemichordata.
From the chapter Animal Kingdom — notes · practice set
Zoology · Question 33
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
- TH cells
- B-lymphocytes
- Basophils
- Eosinophils
Correct option — (1) TH cells
HIV specifically targets the immune system's coordinating cells.
The virus enters the helper T-lymphocytes (TH cells), where it replicates and produces progeny viruses. These new viruses are released into the blood and go on to attack more helper T-cells.
This progressive destruction of helper T-cells is what cripples the immune system in AIDS. The other cell types listed (B-lymphocytes, basophils, eosinophils) are not the primary site of HIV replication.
So the answer is TH cells.
From the chapter Human Health and Disease — notes · practice set
Zoology · Question 34
Which of the following is not a cloning vector?
- BAC
- YAC
- pBR322
- Probe
Correct option — (4) Probe
A cloning vector is a DNA molecule that carries a foreign DNA fragment into a host cell for replication.
• Probe is not a cloning vector. A probe is a single-stranded piece of DNA or RNA tagged with a radioactive (or fluorescent) label, used to detect a specific complementary sequence — for example, to find a mutated gene. It carries nothing into a host.
The other three are all genuine cloning vectors:
• BAC — bacterial artificial chromosome.
• YAC — yeast artificial chromosome.
• pBR322 — a well-known plasmid vector.
So the odd one out is the probe.
From the chapter Biotechnology: Principles and Processes — notes · practice set
Zoology · Question 35
Match List I with List II.
List I: (A) Logistic growth (B) Exponential growth (C) Expanding age pyramid (D) Stable age pyramid
List II: (I) Unlimited resource availability condition (II) Limited resource availability condition (III) Pre-reproductive age largest, followed by reproductive and post-reproductive (IV) Pre-reproductive and reproductive age groups equal
- A-II, B-I, C-III, D-IV
- A-II, B-III, C-I, D-IV
- A-II, B-IV, C-I, D-III
- A-II, B-IV, C-III, D-I
Correct option — (1) A-II, B-I, C-III, D-IV
Match each growth concept to its condition:
• Logistic growth — the realistic S-shaped curve that occurs under limited resources (II).
• Exponential growth — the J-shaped curve that occurs only with unlimited resources (I).
• Expanding age pyramid — a growing population where the pre-reproductive group is largest, tapering through reproductive and post-reproductive (III).
• Stable age pyramid — a steady population where the pre-reproductive and reproductive groups are roughly equal (IV).
So A-II, B-I, C-III, D-IV.
From the chapter Organisms and Populations — notes · practice set
Zoology · Question 36
Select the correct statements with reference to chordates.
(A) Presence of a mid-dorsal, solid and double nerve cord.
(B) Presence of closed circulatory system.
(C) Presence of paired pharyngeal gill slits.
(D) Presence of dorsal heart.
(E) Triploblastic pseudocoelomate animals.
- A, C and D only
- B and C only
- B, D and E only
- C, D and E only
Correct option — (2) B and C only
Recall the fundamental chordate characters, then test each statement.
The correct ones:
• (B) Correct. Chordates have a closed circulatory system.
• (C) Correct. Paired pharyngeal gill slits are a defining chordate feature.
The wrong ones:
• (A) Wrong. The chordate nerve cord is dorsal, hollow and single — not solid and double.
• (D) Wrong. The heart in chordates is ventral, not dorsal.
• (E) Wrong. Chordates are triploblastic and coelomate, not pseudocoelomate.
So only B and C are correct.
From the chapter Animal Kingdom — notes · practice set
Zoology · Question 37
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:
- Limbic system and hypothalamus
- Corpora quadrigemina and hippocampus
- Brain stem and epithalamus
- Corpus callosum and thalamus
Correct option — (1) Limbic system and hypothalamus
Emotions and drives such as sexual behaviour, excitement, pleasure, rage and fear are governed by the emotional-control centres of the brain.
The limbic system together with the hypothalamus regulates these behaviours and emotional expressions. The limbic system (including structures like the amygdala) handles emotion, while the hypothalamus links it to physiological responses.
The other structures do different jobs: corpora quadrigemina (visual/auditory reflexes), corpus callosum (connects the two cerebral hemispheres), thalamus (sensory relay), brain stem (basic life functions).
So the answer is the limbic system and hypothalamus.
From the chapter Neural Control and Coordination — notes · practice set
Zoology · Question 38
The unique mammalian characteristics are:
- hairs, tympanic membrane and mammary glands
- hairs, pinna and mammary glands
- hairs, pinna and indirect development
- pinna, monocondylic skull and mammary glands
Correct option — (2) hairs, pinna and mammary glands
To be 'unique', a feature must be found in mammals and essentially not in other classes.
The genuinely unique mammalian features are hairs, pinna (external ear) and mammary glands (option 2). All three are hallmarks of mammals.
Why the others fail:
• Option 1 — the tympanic membrane (ear drum) is also present in amphibians, so it is not unique.
• Option 3 — indirect development (larval stage) is not a mammalian feature; mammals show direct development.
• Option 4 — mammals have a dicondylic skull; the monocondylic skull belongs to reptiles and birds.
So the unique set is hairs, pinna and mammary glands.
From the chapter Animal Kingdom — notes · practice set
Zoology · Question 39
Which of the following are NOT under the control of thyroid hormone?
(A) Maintenance of water and electrolyte balance
(B) Regulation of basal metabolic rate
(C) Normal rhythm of sleep-wake cycle
(D) Development of immune system
(E) Support the process of RBCs formation
- A and D only
- B and C only
- C and D only
- D and E only
Correct option — (3) C and D only
Thyroid hormones have several roles. The question asks which listed functions are NOT controlled by them.
Under thyroid control (so these are ruled out): (A) maintenance of water and electrolyte balance, (B) regulation of basal metabolic rate, (E) supporting RBC formation.
NOT under thyroid control:
• (C) Normal rhythm of the sleep-wake cycle — this is regulated by melatonin (pineal gland), not thyroid.
• (D) Development of the immune system — not a thyroid function.
So the functions NOT controlled by thyroid hormone are C and D.
From the chapter Chemical Coordination and Integration — notes · practice set
Zoology · Question 40
Select the correct statements.
(A) Tetrad formation is seen during Leptotene.
(B) During Anaphase, the centromeres split and chromatids separate.
(C) Terminalization takes place during Pachytene.
(D) Nucleolus, Golgi complex and ER are reformed during Telophase.
(E) Crossing over takes place between sister chromatids of homologous chromosome.
- A and C only
- B and D only
- A, C and E only
- B and E only
Correct option — (2) B and D only
Test each statement:
The correct ones:
• (B) Correct. In anaphase the centromeres split and sister chromatids separate to opposite poles.
• (D) Correct. During telophase the nucleolus, Golgi complex and ER reform as the cell exits division.
The wrong ones:
• (A) Wrong. Tetrad (bivalent) formation is seen during zygotene, not leptotene.
• (C) Wrong. Terminalisation of chiasmata takes place during diakinesis, not pachytene.
• (E) Wrong. Crossing over occurs between non-sister chromatids of homologous chromosomes, not sister chromatids.
So only B and D are correct.
From the chapter Cell Cycle and Cell Division — notes · practice set
Zoology · Question 41
Match List I with List II.
List I: (A) Mast cells (B) Inner surface of bronchiole (C) Blood (D) Tubular parts of nephron
List II: (I) Ciliated epithelium (II) Areolar connective tissue (III) Cuboidal epithelium (IV) Specialised connective tissue
- A-I, B-II, C-IV, D-III
- A-II, B-III, C-I, D-IV
- A-II, B-I, C-IV, D-III
- A-III, B-IV, C-II, D-I
Correct option — (3) A-II, B-I, C-IV, D-III
Match each with the correct tissue:
• Mast cells are found in areolar connective tissue (along with fibroblasts and macrophages) (II).
• Inner surface of bronchioles is lined by ciliated epithelium (the cilia sweep out mucus and dust) (I).
• Blood is a specialised connective tissue (fluid matrix) (IV).
• Tubular parts of the nephron are lined by cuboidal epithelium (III).
So A-II, B-I, C-IV, D-III.
From the chapter Structural Organisation in Animals — notes · practice set
Zoology · Question 42
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
- Dark brown body colour and anal cerci
- Presence of anal styles
- Presence of sclerites
- Presence of anal cerci
Correct option — (2) Presence of anal styles
Sexual dimorphism means a feature that differs between the sexes. The trick is to find the feature present in only one sex.
• Anal styles are present in male cockroaches and absent in females — so this is the distinguishing (dimorphic) feature.
The other options are common to both sexes, so they cannot distinguish them:
• Dark brown body colour — both sexes.
• Sclerites — both sexes have the sclerite body plates.
• Anal cerci — present in both males and females.
So the sexually dimorphic feature is the presence of anal styles.
From the chapter Structural Organisation in Animals — notes · practice set
Zoology · Question 43
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3'?
- 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
- 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
- 5' ATCGATCGATCGATCGATCGATCGATCG 3'
- 3' ATCGATCGATCGATCGATCGATCGATCG 5'
Correct option — (3) 5' ATCGATCGATCGATCGATCGATCGATCG 3'
The key rule: the coding strand of DNA has the same sequence as the mRNA, except that thymine (T) replaces uracil (U), and it runs in the same 5'→3' direction.
The mRNA is:
5' AUCGAUCG... 3'
Replace every U with T and keep the 5'→3' orientation:
5' ATCGATCG... 3'
That matches option 3. (Option 4 has the correct bases but the wrong 3'→5' direction; the template strand would instead read 3'-TAGCTAGC...-5'.)
So the coding strand is 5' ATCGATCGATCG... 3'.
From the chapter Molecular Basis of Inheritance — notes · practice set
Zoology · Question 44
In cockroach, excretion is brought about by-
(A) Phallic gland (B) Urecose gland (C) Nephrocytes (D) Fat body (E) Collaterial glands
- A and E only
- A, B and E only
- B, C and D only
- B and D only
Correct option — (3) B, C and D only
Cockroach excretion is carried out mainly by the Malpighian tubules, assisted by a few other structures. From the list, the excretory structures are:
• (B) Urecose glands — present in some male cockroaches; they synthesise uric acid.
• (C) Nephrocytes — cells attached to the dorsal diaphragm that take up wastes.
• (D) Fat body — accumulates, produces and stores uric acid.
The two that are NOT excretory:
• (A) Phallic gland — a male reproductive structure (secretes the spermatophore coating).
• (E) Collaterial glands — a female reproductive structure (forms the ootheca around eggs).
So the excretory ones are B, C and D.
From the chapter Excretory Products and Elimination — notes · practice set
Zoology · Question 45
Given below are two statements:
Statement I: During G0 phase of cell cycle, the cell is metabolically inactive.
Statement II: The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer.
- Both Statement I and Statement II are correct
- Both Statement I and Statement II are incorrect
- Statement I is correct but Statement II is incorrect
- Statement I is incorrect but Statement II is correct
Correct option — (4) Statement I is incorrect but Statement II is correct
Statement I is incorrect. Cells in the G0 (quiescent) stage remain metabolically active — they simply stop dividing. They can re-enter the cycle when the organism needs them. So calling them metabolically inactive is wrong.
Statement II is correct. In animal cells the centrosome (with its centrioles) duplicates during the S phase, at the same time as DNA replication occurs in the nucleus.
So Statement I is incorrect but Statement II is correct.
From the chapter Cell Cycle and Cell Division — notes · practice set
Zoology · Question 46
Which one of the following is NOT an advantage of inbreeding?
- It decreases homozygosity.
- It exposes harmful recessive genes but are eliminated by selection.
- Elimination of less desirable genes and accumulation of superior genes takes place due to it.
- It decreases the productivity of inbred population, after continuous inbreeding.
Correct option — (4) It decreases the productivity of inbred population, after continuous inbreeding.
The question asks which statement is NOT an advantage of inbreeding.
• Option 4 — the decrease in productivity of the inbred population after continuous inbreeding (inbreeding depression) is a disadvantage, not an advantage. So this is the answer.
The genuine advantages (options 2 and 3): inbreeding exposes harmful recessive genes so selection can eliminate them, and it helps accumulate superior genes.
Note also that option 1 ('decreases homozygosity') is itself incorrect — inbreeding actually increases homozygosity — but since the question asks specifically for what is not an advantage, the intended answer is the inbreeding-depression statement, option 4.
From the chapter Strategies for Enhancement in Food Production — notes · practice set
Zoology · Question 47
Which of the following statements are correct?
(A) An excessive loss of body fluid from the body switches off osmoreceptors.
(B) ADH facilitates water reabsorption to prevent diuresis.
(C) ANF causes vasodilation.
(D) ADH causes increase in blood pressure.
(E) ADH is responsible for decrease in GFR.
- A and B only
- B, C and D only
- A, B and E only
- C, D and E only
Correct option — (2) B, C and D only
Check each statement:
The correct ones:
• (B) Correct. ADH promotes water reabsorption (from the DCT and collecting duct), preventing excessive water loss (diuresis).
• (C) Correct. ANF (atrial natriuretic factor), secreted by the heart, causes vasodilation.
• (D) Correct. By retaining water, ADH increases blood volume and hence blood pressure.
The wrong ones:
• (A) Wrong. Excessive fluid loss switches on (activates) the osmoreceptors, not off.
• (E) Wrong. ADH is not primarily responsible for decreasing GFR.
So the correct statements are B, C and D.
From the chapter Excretory Products and Elimination — notes · practice set
Zoology · Question 48
Which of the following statements are correct regarding skeletal muscle?
(A) Muscle bundles are held together by collagenous connective tissue layer called fascicle.
(B) Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
(C) Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
(D) M line is considered as functional unit of contraction called sarcomere.
- A, B and C only
- B and C only
- A, C and D only
- C and D only
Correct option — (2) B and C only
Check each statement about skeletal muscle:
The correct ones:
• (B) Correct. The sarcoplasmic reticulum stores calcium ions, which are released to trigger contraction.
• (C) Correct. The striated (banded) appearance arises from the organised distribution of actin (thin) and myosin (thick) filaments.
The wrong ones:
• (A) Wrong. The connective tissue layer holding muscle bundles is called fascia; the bundles themselves are called fascicles. The statement muddles the two terms.
• (D) Wrong. The functional unit of contraction (the sarcomere) is the portion between two successive Z lines, not the M line.
So only B and C are correct.
From the chapter Locomotion and Movement — notes · practice set
Zoology · Question 49
Which of the following statements are correct?
(A) Basophils are most abundant cells of the total WBCs.
(B) Basophils secrete histamine, serotonin and heparin.
(C) Basophils are involved in inflammatory response.
(D) Basophils have kidney shaped nucleus.
(E) Basophils are agranulocytes.
- D and E only
- C and E only
- B and C only
- A and B only
Correct option — (3) B and C only
Check each statement about basophils:
The correct ones:
• (B) Correct. Basophils secrete histamine, serotonin and heparin.
• (C) Correct. They are involved in the inflammatory response (and allergic reactions).
The wrong ones:
• (A) Wrong. Basophils are the least abundant WBCs (0.5–1%). Neutrophils are the most abundant (60–65%).
• (D) Wrong. A kidney-shaped nucleus belongs to monocytes, not basophils.
• (E) Wrong. Basophils are granulocytes, not agranulocytes.
So only B and C are correct.
From the chapter Body Fluids and Circulation — notes · practice set